ID: 946994547

View in Genome Browser
Species Human (GRCh38)
Location 2:225376439-225376461
Sequence TCTCCCCTTGAAGGGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946994541_946994547 0 Left 946994541 2:225376416-225376438 CCCTTGAGTAGAGACAACCTTGC No data
Right 946994547 2:225376439-225376461 TCTCCCCTTGAAGGGGATTTTGG No data
946994542_946994547 -1 Left 946994542 2:225376417-225376439 CCTTGAGTAGAGACAACCTTGCT No data
Right 946994547 2:225376439-225376461 TCTCCCCTTGAAGGGGATTTTGG No data
946994540_946994547 3 Left 946994540 2:225376413-225376435 CCACCCTTGAGTAGAGACAACCT No data
Right 946994547 2:225376439-225376461 TCTCCCCTTGAAGGGGATTTTGG No data
946994539_946994547 9 Left 946994539 2:225376407-225376429 CCAATTCCACCCTTGAGTAGAGA No data
Right 946994547 2:225376439-225376461 TCTCCCCTTGAAGGGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946994547 Original CRISPR TCTCCCCTTGAAGGGGATTT TGG Intergenic
No off target data available for this crispr