ID: 946998268

View in Genome Browser
Species Human (GRCh38)
Location 2:225421155-225421177
Sequence AGCGTTTGGAAGCCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946998268_946998276 15 Left 946998268 2:225421155-225421177 CCCTCCCCAGGCTTCCAAACGCT 0: 1
1: 0
2: 1
3: 22
4: 247
Right 946998276 2:225421193-225421215 AGTCACCACACCTAGTGAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946998268 Original CRISPR AGCGTTTGGAAGCCTGGGGA GGG (reversed) Intronic
900368297 1:2320386-2320408 ACCGTTTGCAGCCCTGGGGAGGG - Intergenic
901325086 1:8360863-8360885 GGCCTTGGGAGGCCTGGGGAGGG + Exonic
901939504 1:12651323-12651345 AGTATTTGGGAGCCTGGGTAAGG + Exonic
901943931 1:12685508-12685530 GGAGTTTGGAAGCCTGGGTAAGG + Intergenic
903059653 1:20661151-20661173 AGCGTGTGGGGGCCTGGGGTTGG - Intronic
903362019 1:22782893-22782915 AGGGGCTGGCAGCCTGGGGAGGG - Intronic
903479957 1:23645764-23645786 AGCCTCTGGAGGCCTGGGGTGGG + Intergenic
904387226 1:30151387-30151409 AGAGTTTGGAAGAGTGTGGAGGG + Intergenic
904613379 1:31737122-31737144 AGCGTGTGGAAGCCTGAGTGAGG - Intronic
904873533 1:33636339-33636361 AGGTGGTGGAAGCCTGGGGATGG - Exonic
907943001 1:59107098-59107120 AGCCTTTGGGAGGCTGGGGCAGG - Intergenic
908325330 1:63017961-63017983 AGCCTTTGGAAACTTGGGTAGGG - Intergenic
909470982 1:76027838-76027860 AGAGTTTCCAAGGCTGGGGATGG - Intergenic
909827271 1:80142291-80142313 AGCCTTTAAAAGACTGGGGAGGG + Intergenic
914875457 1:151510224-151510246 AGCTTTTGAAGGCTTGGGGAGGG + Intergenic
915313053 1:155013930-155013952 AACTTTTGGTAGCCAGGGGAGGG + Intronic
915523874 1:156464483-156464505 AGCTGTGGGAAACCTGGGGAGGG + Exonic
915943382 1:160133184-160133206 AGTATGTGGAAGCCAGGGGAGGG + Intronic
916294685 1:163204594-163204616 AGTGTTTGGAAGGCTGAGGCAGG - Intronic
917238341 1:172919015-172919037 TGAGTTTGGGAGCCTGGGAAGGG - Intergenic
917687526 1:177432398-177432420 AGCATTTAGAAGGCTGGGAAAGG + Intergenic
917952592 1:180055790-180055812 AGCATTTGGGAGGCTGAGGATGG - Intronic
917974130 1:180228839-180228861 AGGTTCTGGAAGGCTGGGGAGGG + Intergenic
919905204 1:202073683-202073705 AGGCTTTGGAGGCCTGAGGAAGG + Intergenic
922237509 1:223733207-223733229 AGAGTTGGGGAGCCAGGGGAGGG - Intronic
1063216394 10:3929808-3929830 AGCCTTTGGGAGCTGGGGGATGG + Intergenic
1063354857 10:5388477-5388499 AGCATTTGGGAGGCTGAGGAGGG + Intergenic
1064144295 10:12815446-12815468 AGCATTTGGAAACCTGGGCCTGG + Intronic
1064368586 10:14730461-14730483 AGCATTAGGAAGCCCAGGGAGGG + Intronic
1065416999 10:25499312-25499334 AGGGTTTGGAGCCCTGGGTATGG - Intronic
1066253186 10:33653934-33653956 AGCATTTGGGAGGCTGGGGTGGG + Intergenic
1067173242 10:43924480-43924502 GGGGCCTGGAAGCCTGGGGATGG + Intergenic
1069698260 10:70403934-70403956 AGTGTTTGTGAGCCTGGTGAAGG - Intergenic
1072109790 10:92307626-92307648 AGCATTTGGGAGCCTGAGGTGGG + Intronic
1073600903 10:104845169-104845191 GGAATTTGGAATCCTGGGGAAGG - Intronic
1073647916 10:105325366-105325388 AGGGCTTGAAGGCCTGGGGAGGG + Intergenic
1073881485 10:107986071-107986093 AGAGTTAGGAAACCTGGGGGTGG - Intergenic
1076216300 10:128696237-128696259 AGCTTCTGGATTCCTGGGGAAGG - Intergenic
1077681035 11:4240188-4240210 AGAGGTTGGAAGCTTGGGGGAGG - Intergenic
1077689863 11:4332300-4332322 AGAGGTTGGAAGCTTGGGGGAGG + Intergenic
1078602610 11:12747017-12747039 GGTGTTTGGAAACCTGAGGAAGG + Intronic
1079833917 11:25307051-25307073 AGGGGTTGGGAGGCTGGGGAGGG + Intergenic
1083990565 11:66243583-66243605 AGAGTTTGGAAGTCGGGTGAAGG - Exonic
1084066178 11:66705594-66705616 AGGGTTGGGAAACCTGGGGACGG - Intronic
1084127415 11:67109120-67109142 AGCCTTTGGAAGGCTGAGGCAGG + Intergenic
1084782512 11:71419695-71419717 AGCATTTGGGAGCCTGAGGTGGG - Intergenic
1086121825 11:83312467-83312489 ACCATGAGGAAGCCTGGGGAGGG - Intergenic
1086843411 11:91717810-91717832 AGCATTTGGGAGCCTTTGGAAGG - Intergenic
1088976057 11:114817457-114817479 AGCGCTTGGATGCTTTGGGAGGG + Intergenic
1089365342 11:117917940-117917962 ACAATTTGGAAGGCTGGGGATGG + Intronic
1089422851 11:118344493-118344515 GGGGTCTGGAAGCCTGGGGAAGG + Intronic
1089646855 11:119886269-119886291 AGGGCTGGGGAGCCTGGGGAGGG - Intergenic
1091390206 12:121612-121634 TCCATTTGGAAGGCTGGGGAAGG + Intronic
1092292990 12:7175365-7175387 AGAGTAGGGAAGTCTGGGGATGG - Intergenic
1095464437 12:42475844-42475866 AGCATTTGGGAGGCTGGGGGGGG + Intronic
1096613494 12:52818508-52818530 TGCGTGTGGAGGTCTGGGGAGGG - Intergenic
1096714983 12:53485972-53485994 ATGGTTTGGAAGCCGGGAGAAGG + Intronic
1096716514 12:53494517-53494539 AGATTTTGGAAGCCTGTGGCAGG + Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097633755 12:62096787-62096809 ACAGTTTGGCAGCTTGGGGAAGG - Intronic
1099838345 12:87936229-87936251 AGAGTTTGGAAGAGTGTGGAGGG + Intergenic
1102692759 12:114774281-114774303 AGGGCTTGGGAGCCTGGGGGTGG + Intergenic
1104038060 12:125112220-125112242 AGCTTTTGAGTGCCTGGGGAAGG + Intronic
1104769955 12:131355298-131355320 CACGTTTGGAAGCCTTGGGAAGG + Intergenic
1105004360 12:132711538-132711560 AGCGTTTGGGAGGCTGAGGCCGG + Intronic
1106129162 13:26925307-26925329 TGCGATGGGAAGCCTTGGGAGGG + Intergenic
1110264881 13:73526024-73526046 ATGGATTGGAAGCATGGGGAGGG + Intergenic
1113594738 13:111522985-111523007 TGGCTTTGGGAGCCTGGGGATGG + Intergenic
1115992348 14:39163123-39163145 AGCATTTGGAAGGCTGAGGTGGG + Intronic
1117129983 14:52676503-52676525 AGCCTTGGGAAGCACGGGGAAGG - Intronic
1117675183 14:58148390-58148412 AGGGTTTGGATACCTGGGTAGGG - Intronic
1118316701 14:64730158-64730180 AGGGTTTGGGAGGTTGGGGAGGG + Intronic
1119183563 14:72620492-72620514 AGCTTCTGGAAGCCGAGGGATGG - Intronic
1120451417 14:84671949-84671971 AGAATTTGGAAGCCTCAGGAGGG + Intergenic
1121423987 14:93835086-93835108 AGTGTTGGGAAGACTTGGGAGGG + Intergenic
1125388819 15:39169698-39169720 AGCGATCGAAAGCCTGGGCATGG - Intergenic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1126411972 15:48381311-48381333 AGCCTTTTGAAGCCAGGGGCAGG + Intergenic
1126778260 15:52118002-52118024 GACGCCTGGAAGCCTGGGGAAGG - Exonic
1127937088 15:63651789-63651811 AGCATTTGGGAGGCTGGGGCAGG + Intronic
1128612133 15:69082674-69082696 TGGGTGTGGAATCCTGGGGAAGG - Intergenic
1129927908 15:79382577-79382599 AGCTTCTGGTAGCCTGGGGAAGG - Intronic
1131085404 15:89571999-89572021 AATGTTAGGAAGCCAGGGGAAGG - Intergenic
1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG + Intronic
1132028647 15:98422651-98422673 AGCCTTTGCAGGCCTGGGGCTGG - Intergenic
1132110087 15:99096490-99096512 AGCCCTGGGAAGCCTGGGAAAGG + Intergenic
1132828093 16:1914825-1914847 AGGCTTCGGATGCCTGGGGAGGG - Intronic
1134666456 16:16022337-16022359 GGCTTTTGGGAGCCTGGGCAGGG + Intronic
1135396283 16:22134212-22134234 AGCATTTGGGAGGCTGAGGAGGG - Intronic
1136235763 16:28912720-28912742 AGCTTTTGAAAGCCTGGAGCCGG + Intronic
1136391337 16:29966566-29966588 AGCCTTTGGAAGGCTGAGGCAGG + Intronic
1137930338 16:52581237-52581259 AGCATCTGGAAGAGTGGGGATGG - Intergenic
1139288543 16:65836702-65836724 AGGATTTGGAAACCTGGTGATGG + Intergenic
1140198594 16:72876460-72876482 AGTGGTTGGATGGCTGGGGATGG - Intronic
1140222443 16:73053749-73053771 AGCCTGTGGCTGCCTGGGGAAGG - Intronic
1140699764 16:77570954-77570976 AGAGTGTGGAAGCCGGGGTAGGG - Intergenic
1141661587 16:85444502-85444524 AGCCTGAGGAACCCTGGGGAGGG + Intergenic
1142420213 16:89965519-89965541 ACAGTTTGGGAGCCAGGGGAGGG + Intronic
1142962071 17:3557408-3557430 AGGTTTGGGAATCCTGGGGAGGG - Intronic
1143447257 17:7016837-7016859 AGCTTTGGGAAGCTTGGGGCTGG + Intronic
1146307494 17:31741785-31741807 AGCATTGGGAAGGCAGGGGAAGG + Intergenic
1146911891 17:36653715-36653737 GGCCTTAGGAGGCCTGGGGAGGG - Intergenic
1147209501 17:38863885-38863907 TGCGTTTCGAAGCCTGGCGCGGG - Intergenic
1147714274 17:42493951-42493973 AGATTATGGAAGCCTGGGCACGG + Intronic
1147805002 17:43125116-43125138 GGCGTTGTGAACCCTGGGGAGGG - Intronic
1147880245 17:43648819-43648841 AGCTGTGGGAAGGCTGGGGAGGG - Intronic
1148898042 17:50851875-50851897 AACTTAGGGAAGCCTGGGGAAGG + Intergenic
1149010099 17:51847371-51847393 AGCTTTTGACAGCCTGGGGGTGG + Intronic
1149321162 17:55482430-55482452 AGCCTGTGGAAGCCTGGAGAAGG - Intergenic
1151045573 17:70916475-70916497 AGAGTTTGGAAGAGTGTGGAGGG + Intergenic
1151451794 17:74202738-74202760 AGGCTTGGGAAGCCTGGGGAGGG - Intergenic
1152074851 17:78152716-78152738 AGCTTTTGGAGGCCTAGGCAGGG - Intronic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1159441313 18:68484441-68484463 AGCATTTGGAAGCCTGAGACTGG + Intergenic
1159524675 18:69572624-69572646 AACGTTTGGAAGACTAGTGAAGG + Intronic
1162518527 19:11165264-11165286 TGCGCTGGGAGGCCTGGGGACGG + Intronic
1162903008 19:13806418-13806440 AGCATTTGGGAGGCTGAGGAAGG + Intronic
1163257788 19:16168098-16168120 GGGGTTGGGAAGCATGGGGATGG - Intronic
1164053164 19:21600214-21600236 AAAGTTTGGGAGCCTGAGGAAGG - Intergenic
1165378050 19:35457423-35457445 AGCTTCTGGAAGCCAGGTGAAGG - Intergenic
1165634698 19:37330938-37330960 AGCGTTTGGGAGGCTGAGGCGGG + Intronic
1165661291 19:37582594-37582616 AGCATTTGGAAGCCTGTGGGTGG - Intronic
1165661296 19:37582675-37582697 AGGGTTTGGAAGGCTGGAGAAGG - Intronic
1165950765 19:39472941-39472963 GGCCTGTGGAGGCCTGGGGAGGG + Intronic
1166578509 19:43868192-43868214 AGCATTTGGAAGGCTGAGGCAGG - Intergenic
1166928058 19:46283020-46283042 AGCATTTGGAAGGCTGAGGCAGG + Intergenic
1167591526 19:50406884-50406906 AGGGTGAGGTAGCCTGGGGAGGG - Intronic
1168622361 19:57889451-57889473 AGGGTTAGGGAGCCTGAGGAGGG + Intronic
926094796 2:10074089-10074111 AGCGTGTGGATGGGTGGGGAAGG - Intronic
928062009 2:28123505-28123527 AGCATTTGGAAAACAGGGGATGG - Intronic
933898278 2:86831179-86831201 AGCGATTGGAAGTCTGAGGCAGG - Intronic
939538290 2:143460966-143460988 AGCAATTTGAAGCCTGAGGAAGG - Intronic
940207932 2:151224755-151224777 AGCATTTGGGAGGCTGAGGAGGG - Intergenic
941002869 2:160219945-160219967 CCCATTTGGAAGCCTGGAGATGG - Intronic
941003642 2:160225883-160225905 TGCGTCTGGCAGCCTGTGGAGGG + Intronic
942045405 2:172096720-172096742 AGCGCTGGGAAGCAGGGGGAGGG - Intergenic
942965204 2:181884252-181884274 AGTGAATGGAATCCTGGGGAGGG - Intergenic
946998268 2:225421155-225421177 AGCGTTTGGAAGCCTGGGGAGGG - Intronic
948585627 2:239017061-239017083 ACAGTTTGGAGGCATGGGGAAGG + Intergenic
1169266774 20:4171993-4172015 AGCGTTGGGAAGCCAGGATAGGG - Intronic
1169622578 20:7524670-7524692 AGCCTTTGCCAGCATGGGGATGG - Intergenic
1169892047 20:10463944-10463966 AAGTTTTGGAAGGCTGGGGAAGG + Intronic
1170113939 20:12836802-12836824 AGCATTTGGGAGCCCGAGGAGGG - Intergenic
1172883271 20:38215325-38215347 ATAGGCTGGAAGCCTGGGGATGG - Intronic
1173354979 20:42278843-42278865 AGCATGTGGAAGCTTGGGGTAGG - Intronic
1173584935 20:44175484-44175506 GGCATTTGGAAGCCATGGGAAGG - Intronic
1174187081 20:48713623-48713645 AGCTTTTGGAAGGCTGAGGTGGG + Intronic
1175465015 20:59184994-59185016 TGCGTGTGGGAGCCTGGGGATGG + Intergenic
1176296709 21:5076883-5076905 AGGGGCTGGAAGCCTGGGCAGGG + Intergenic
1178293575 21:31389497-31389519 ATGGTTGGGAAGCCTGGGGGCGG - Intronic
1179860340 21:44185238-44185260 AGGGGCTGGAAGCCTGGGCAGGG - Intergenic
1181269672 22:21651878-21651900 AGCGCTTGGAAGCCCGGTGAGGG - Intergenic
1182584977 22:31339779-31339801 AGCTTTAGGAAGTCTGGGAAGGG - Intronic
1183548260 22:38466970-38466992 AGCATTTGGAAGGCTGAGGCAGG + Intergenic
1184929988 22:47673818-47673840 AGAGCTTGGAAGGGTGGGGAGGG + Intergenic
1185037805 22:48489090-48489112 AGGGCCTGGAAGGCTGGGGAGGG - Intergenic
950003933 3:9679268-9679290 ATGGTCTGGAAGCCTGGAGAAGG + Intronic
953854579 3:46491281-46491303 TGAGTTTGGAAGTCTGTGGATGG - Intergenic
954427563 3:50451444-50451466 AGTGTCAGGCAGCCTGGGGAGGG - Intronic
954686559 3:52373244-52373266 AGCCTCTGGAAGCCTGGAAAAGG + Intronic
955385013 3:58472307-58472329 AGAGTCTGGAAGCCTGTGGAAGG - Intergenic
958837297 3:99160048-99160070 AGAGTTTGGAAGAGTGTGGAGGG - Intergenic
960571539 3:119189406-119189428 AGTGTGTGCAAGCCTGGGGAAGG + Intronic
960904208 3:122583230-122583252 AGCGTTTAGGAGGCTGAGGAAGG - Intronic
961340570 3:126214244-126214266 AGGCATTGGAAGCCTGGGAAGGG - Intergenic
964083222 3:152785496-152785518 ACCGCATGGAAGCCAGGGGAAGG - Intergenic
964607231 3:158571954-158571976 AGGGTTTGGGAGCGTGGGGTGGG + Intronic
964647068 3:158969672-158969694 AGCTTTGGGCAGCCTGGGGCAGG + Intronic
964726415 3:159818567-159818589 ACCGTAGGGAAGCCTGGGGCAGG + Intronic
965659049 3:171021537-171021559 AGCGTTTGGGAGGCTGAGGCTGG + Intronic
966895917 3:184444959-184444981 AACGTTTAGAAGTCTGGAGAAGG - Intronic
967926404 3:194652226-194652248 AGGGTATGTAAGGCTGGGGATGG + Intronic
968618396 4:1592649-1592671 AGAGCCTGGAAGCCTGGGGATGG + Intergenic
969919902 4:10527961-10527983 ATTGTTTGGAAGCCTGGGATGGG - Intronic
970058395 4:12001151-12001173 AGAGTTTGGAAGGATGTGGAGGG - Intergenic
972358701 4:38306134-38306156 AGCCTTTGGAAGGCTGAGGCAGG + Intergenic
975767928 4:77688532-77688554 ATTGTTGGGAAGCCTGGAGAAGG - Intergenic
977625137 4:99181698-99181720 AATGTTTGGAAGCCTGAGGTGGG - Intergenic
978143920 4:105349546-105349568 ACAGTTTGGAAGGCTGAGGAGGG + Intergenic
982026507 4:151257668-151257690 ATGCTTTGGGAGCCTGGGGAGGG + Intronic
982447371 4:155508645-155508667 AGCCTTTGGAAGGCTGAGGTGGG - Intergenic
983129925 4:164005710-164005732 ATTGTTTCCAAGCCTGGGGATGG - Intronic
983312872 4:166087753-166087775 AGCGTCTGGAAGCCTGGCCAGGG + Intronic
984930629 4:184844232-184844254 AGCTTTTGGAAGCCTAGGCGCGG + Intergenic
984985938 4:185329558-185329580 ACCGCTTGAAAGCCTGGGGAAGG + Intronic
990255816 5:53967755-53967777 AGCGATCAGAAGCCAGGGGATGG + Intronic
990399464 5:55423540-55423562 AGAGTTGAGAAGCCTGGGGCTGG - Intronic
991408541 5:66324755-66324777 AGGGTTTGGAAACCTGGGGAAGG - Intergenic
991442029 5:66660682-66660704 AGTTTTTGTAAGCCTTGGGAAGG + Intronic
995289726 5:110438047-110438069 AATGTTAGAAAGCCTGGGGATGG - Intronic
997459014 5:134039758-134039780 AGGGTTTGGGAGCCGGGAGATGG - Intergenic
998493685 5:142568478-142568500 GGCCTTTGGAAGCCTCTGGAAGG - Intergenic
999194641 5:149773761-149773783 AGCGCTTGGAGGCGTGGGGGAGG + Intronic
999411998 5:151358499-151358521 AGCATTTGGAAGGCTGAGGCAGG - Intergenic
999974533 5:156897738-156897760 ACAGTTTGGAAGGCTGAGGAGGG - Intergenic
1000494728 5:161967500-161967522 AGGGTTTGGAAGGCTGAGGTGGG + Intergenic
1001833870 5:174813505-174813527 AGAGTTGGGAAGCGGGGGGAAGG - Intergenic
1001957234 5:175856448-175856470 TGCATTTGAAAGCCTGGGGCTGG - Intronic
1004367828 6:15026943-15026965 AGAGTGTGGAAGCCAGGGAAGGG + Intergenic
1004583713 6:16979196-16979218 GAGATTTGGAAGCCTGGGGATGG - Intergenic
1005017833 6:21390848-21390870 TGAGTTTGGAAGGCTGGGGATGG - Intergenic
1006388032 6:33742896-33742918 AGCCTTGGGGAGCTTGGGGAGGG + Intronic
1006399031 6:33805285-33805307 AGCGTCTGGATGTGTGGGGAAGG - Intergenic
1006436020 6:34026600-34026622 GGGGTGTGGAGGCCTGGGGAGGG - Intronic
1006758082 6:36435190-36435212 AGCATTTGGGAGGCTGAGGAGGG + Intronic
1012276745 6:97283234-97283256 GGCGATTGGTAGCCGGGGGAGGG - Intergenic
1015070110 6:129082470-129082492 AACGTTTGGAAACCTGGAAATGG - Intronic
1015110549 6:129587812-129587834 AGATTTTGGAAGGCTGGGGATGG - Intronic
1015185001 6:130405777-130405799 TGGGTCAGGAAGCCTGGGGAGGG - Intronic
1015575095 6:134662772-134662794 AGAGGTTGGAAACCTGGAGATGG + Intergenic
1016324051 6:142879732-142879754 AGACTGTGGAAGCCTGGGGAGGG - Intronic
1017228897 6:152051330-152051352 AGTGCTGGGCAGCCTGGGGATGG - Intronic
1020116686 7:5480114-5480136 GGTGATTGGAGGCCTGGGGATGG + Intronic
1021508160 7:21407735-21407757 AGAGTGTTGAAGCCTGGAGAGGG + Intergenic
1021853162 7:24828270-24828292 AGAGTTTGGAAGGCTGAGGTAGG - Intronic
1022227106 7:28374666-28374688 AGCGTTTGGTTGCCTGGAGCTGG + Intronic
1022918038 7:34980996-34981018 AGAGTTTTGAAGGATGGGGAGGG + Intronic
1023766919 7:43520424-43520446 AGCCTAAGGAAGCGTGGGGAGGG - Intronic
1023823775 7:43995103-43995125 AGGGTGGGGAAGACTGGGGATGG + Intergenic
1024000389 7:45185506-45185528 AGGGTTTGGATTCCTGGGGATGG + Intronic
1024088208 7:45914699-45914721 TGGGTCTGTAAGCCTGGGGAAGG + Intronic
1024554824 7:50594327-50594349 AGCTTTTGTGAGCCAGGGGAAGG - Intronic
1025509760 7:61494640-61494662 AGCGTTTTGAAGGCTGTGGTTGG + Intergenic
1025855293 7:65271058-65271080 AAAGTTTGGGGGCCTGGGGAAGG + Intergenic
1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG + Intergenic
1029752042 7:102548516-102548538 AGGGTGGGGAAGACTGGGGATGG + Intronic
1029769994 7:102647610-102647632 AGGGTGGGGAAGACTGGGGATGG + Intronic
1033411281 7:141119862-141119884 AGTGTTTGGAGGCCTGGAGCAGG + Intronic
1035188098 7:157141313-157141335 AGCCTCTGGAATGCTGGGGATGG - Intronic
1036135380 8:6155516-6155538 TGCGTGTGGAGGCCTGGTGATGG + Intergenic
1038293944 8:26273901-26273923 AGGGGTTGTAAGCCTGGGCACGG - Intergenic
1038373537 8:27015304-27015326 AGCATTTGGGAGGCTGGGGTAGG + Intergenic
1038412780 8:27371139-27371161 AGCGTTTGGGAGGCTGAGGCGGG - Intronic
1039318581 8:36401523-36401545 AGTGTTTGGAGGCCTGTGGGTGG + Intergenic
1040672484 8:49708881-49708903 AATGTTTGGAAGCCTGAGGTGGG - Intergenic
1041821384 8:62037842-62037864 AGTATTTGGAAGCCTGAGGCAGG + Intergenic
1043577032 8:81669687-81669709 AGACTTTGGGACCCTGGGGATGG + Intronic
1048275924 8:133065903-133065925 AGTGTTTGGAAGCCCGGGTCTGG + Intronic
1049093041 8:140531066-140531088 AGTGTTTTGGAGCCTGGAGATGG - Intergenic
1050777679 9:9286976-9286998 AGCATTTGGAAGGCTGAGGCGGG + Intronic
1051809874 9:21036774-21036796 AACGAATGGAGGCCTGGGGATGG - Intergenic
1052516038 9:29481261-29481283 AGGGTGTGGGGGCCTGGGGAGGG - Intergenic
1056147192 9:83744148-83744170 AGTGTTTATAATCCTGGGGATGG - Intronic
1057446197 9:95116775-95116797 AGCCTTTGGAAGGCTGGCAAAGG + Intronic
1057913107 9:99035340-99035362 AGCCTTCGGTATCCTGGGGAAGG - Exonic
1060612864 9:124984280-124984302 TGTTTTTGGAAGACTGGGGAGGG + Intronic
1061439391 9:130589960-130589982 AGCACTTGGAAGGCTGGGGTAGG - Intronic
1061843191 9:133372114-133372136 GGCATTTGGAAGCCATGGGAAGG - Intronic
1061852513 9:133424329-133424351 TGCCTCTGGAAGCCAGGGGAAGG - Exonic
1061906255 9:133700776-133700798 GGCATTTGTAAACCTGGGGAAGG - Intronic
1062067890 9:134538612-134538634 AGCCTTGGGAGACCTGGGGAAGG - Intergenic
1062208684 9:135351499-135351521 GGGGTGTGGAAGGCTGGGGAGGG - Intergenic
1186423407 X:9444394-9444416 AGGGTTTTGAAGAGTGGGGAGGG - Intergenic
1186967014 X:14798450-14798472 AGCATTTTGAAGGCTGGGCACGG - Intergenic
1187909951 X:24102342-24102364 ACAGTTTGGAAGCCTGAGGTAGG - Intergenic
1189103953 X:38218782-38218804 AGGCTTTGGAAGGCTGGGGAGGG - Intronic
1191245214 X:58223250-58223272 ATCATTAGGAAGCCTGGGGCTGG - Intergenic
1193026378 X:76850177-76850199 AGAGTTTGGAAGAGTGTGGAAGG - Intergenic
1194306930 X:92259152-92259174 AGAGGTTGGAAGACTGTGGAGGG - Intronic
1194979364 X:100424553-100424575 AGAGATTGGAAGGCTGGGAAAGG + Intergenic
1195715894 X:107818496-107818518 AGAGGTTGGAAGACTGTGGAGGG + Intergenic
1196063511 X:111437334-111437356 AGGATTTGGAGGACTGGGGAAGG - Intergenic
1196420785 X:115519010-115519032 AGAGGTAGGAAGCCTGGGGTAGG - Intergenic
1196604495 X:117641461-117641483 AGCAGTTGGAAGGTTGGGGAAGG - Intergenic
1196649317 X:118152845-118152867 AGAGTGTGGGAGGCTGGGGAAGG - Intergenic
1197152288 X:123233233-123233255 AACCTTGGGAAGCCTGGGAATGG - Intronic
1197645569 X:129012898-129012920 AAAGTTGGGAAGGCTGGGGAGGG + Intergenic
1199765261 X:150936699-150936721 GGCGTTTGAATGCCTGGGAAAGG - Intergenic
1199802604 X:151266265-151266287 AATGATTGGAAGCCTGGGGTTGG - Intergenic
1200212396 X:154352525-154352547 GGCTGTGGGAAGCCTGGGGAGGG - Intronic
1202115808 Y:21468135-21468157 GGCGTCTGGTAGCCTGGGGCTGG + Intergenic