ID: 946999792

View in Genome Browser
Species Human (GRCh38)
Location 2:225440853-225440875
Sequence TGAATTGCCCTGATAATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946999791_946999792 -10 Left 946999791 2:225440840-225440862 CCTGCAGATTGGATGAATTGCCC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 946999792 2:225440853-225440875 TGAATTGCCCTGATAATAGATGG 0: 1
1: 0
2: 0
3: 10
4: 113
946999789_946999792 6 Left 946999789 2:225440824-225440846 CCTAGAATTTTGAGAACCTGCAG 0: 1
1: 0
2: 0
3: 17
4: 453
Right 946999792 2:225440853-225440875 TGAATTGCCCTGATAATAGATGG 0: 1
1: 0
2: 0
3: 10
4: 113
946999788_946999792 29 Left 946999788 2:225440801-225440823 CCTGGTGGGTAGGAATAAGTTTG 0: 1
1: 0
2: 1
3: 3
4: 90
Right 946999792 2:225440853-225440875 TGAATTGCCCTGATAATAGATGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946999792 Original CRISPR TGAATTGCCCTGATAATAGA TGG Intronic
902600663 1:17538843-17538865 TGAATTTCCTTGCAAATAGAGGG + Intergenic
906512473 1:46418390-46418412 TGAAGTGCCCAGAAAGTAGATGG - Intergenic
908316851 1:62941079-62941101 TCAATTGCAGTGATAAGAGACGG + Intergenic
908934622 1:69359556-69359578 TGAATAGCACTGATAACTGATGG + Intergenic
916316007 1:163448237-163448259 TGAAATGTCCTGATCATGGAAGG - Intergenic
916975937 1:170078287-170078309 TGAATTTCCCTGATTATTAATGG + Intronic
917449430 1:175134753-175134775 AGGAATGCCCTGAGAATAGATGG - Intronic
920766040 1:208834897-208834919 TGAATAGCCCTGAAATTAGAAGG + Intergenic
921805267 1:219446713-219446735 TTAGTTGCCATGATAATAGGAGG - Intergenic
922158443 1:223059424-223059446 TGCATAGCACTGATAATTGATGG + Intergenic
924390413 1:243549403-243549425 GGAATTGTTCAGATAATAGATGG - Intronic
924418880 1:243888395-243888417 GGAAATGCCCTTATTATAGACGG - Intergenic
1066337496 10:34493879-34493901 GGTATTTCCATGATAATAGATGG - Intronic
1068753689 10:60625728-60625750 TTATTTGCCGTGATACTAGAAGG + Intronic
1069123386 10:64598044-64598066 TGAAATGACCTTATTATAGAAGG - Intergenic
1072320889 10:94248735-94248757 TGAATTTTCCTGATTCTAGAAGG - Intronic
1076575794 10:131466138-131466160 TGCATTTCCCTGATGATATATGG + Intergenic
1083038118 11:59659271-59659293 TGCACTGCCCTCATAATAGCTGG + Exonic
1085475449 11:76786034-76786056 TGGATTGCACTGACAATAGAAGG + Intronic
1090518392 11:127452547-127452569 AGAAATGCCCTAATAATAGACGG + Intergenic
1093396507 12:18689867-18689889 TGACTTGCTCAGATAGTAGAAGG - Intronic
1094393103 12:29974756-29974778 TGAATTGGCCTGATAGCTGAGGG + Intergenic
1094820912 12:34223740-34223762 TCAAATGCCCTGAAAACAGAGGG - Intergenic
1100339484 12:93664616-93664638 TGAAGTGCCCTGAGACTACATGG + Intergenic
1101685019 12:107010792-107010814 TGAATTGCACCCATAAAAGAGGG + Intronic
1108948939 13:56062836-56062858 TGAAATGCCCTAATCATAAATGG - Intergenic
1111060501 13:83012428-83012450 TCAAATGACCTGATAATGGAGGG - Intergenic
1111202577 13:84959869-84959891 TGCATTTCCCTGATTATAGTGGG + Intergenic
1111351637 13:87038343-87038365 TGAAATGCCCAGATAATCGAAGG - Intergenic
1115202662 14:30871268-30871290 TGCATTCCCCTGATAAAAAATGG - Intergenic
1116105112 14:40492734-40492756 AAAATTGCCCTAAGAATAGAAGG - Intergenic
1117171584 14:53106036-53106058 TGGATTGACCAGATAATAAAAGG - Intronic
1117593916 14:57306931-57306953 TGAATGCCCCTGTTAGTAGAAGG - Intergenic
1118591262 14:67403153-67403175 TGCATTTCCCTGATAATCAATGG + Intronic
1119374987 14:74183431-74183453 TTAATTGGCCTGGAAATAGATGG - Intronic
1121872942 14:97426161-97426183 GGAATTGACCTGATAAGATAAGG + Intergenic
1202915375 14_GL000194v1_random:165711-165733 TAAACTGCCCTGATCACAGAAGG - Intergenic
1149373831 17:56023529-56023551 TGAACTGCCTTGAAAAAAGAAGG - Intergenic
1154337798 18:13479840-13479862 TGCATTTCCCTGATAACATATGG - Intronic
1156657455 18:39305933-39305955 TGAAGTGCACAGATAATAAAGGG - Intergenic
1157164494 18:45346044-45346066 TGCATTTCCCTGATAACAAAAGG + Intronic
1157979494 18:52364478-52364500 TTAATTGCATTCATAATAGATGG - Intronic
1158084888 18:53639518-53639540 TGTATTGTCCAAATAATAGAAGG + Intergenic
1162139578 19:8577671-8577693 TGAATCGCCCTGAAAAGAGGTGG - Intergenic
1165229580 19:34378540-34378562 AGCCATGCCCTGATAATAGAGGG + Intronic
925446711 2:3932462-3932484 TGCATTTCCCTGATAATTAATGG + Intergenic
926489060 2:13501217-13501239 TATATTGCACTGATAACAGAAGG - Intergenic
929866789 2:45724293-45724315 TGAATTGCCCCCATATAAGATGG + Intronic
937295620 2:120808187-120808209 AGAATTGCAGGGATAATAGAAGG - Intronic
941251613 2:163172134-163172156 AGAATTGTCCTGATAATGTAAGG + Intergenic
941620160 2:167768544-167768566 TAAATTCCACTGATAATAGGAGG + Intergenic
941772150 2:169356572-169356594 TGGATTTCCCAGATAATAAATGG + Intronic
943899292 2:193411726-193411748 TGCATTGCCTTGATAATTAAAGG + Intergenic
944101190 2:196029930-196029952 TAAATTGCCCTGAAAAAAAATGG + Intronic
946999792 2:225440853-225440875 TGAATTGCCCTGATAATAGATGG + Intronic
1169243633 20:4007022-4007044 TGAATTGCTCAGATAATTGAAGG + Intronic
1175077295 20:56386633-56386655 TGAATGTCACTGATAAGAGATGG + Intronic
1176634725 21:9180355-9180377 TAAACTGCCCTGATCACAGAAGG - Intergenic
1179797489 21:43793866-43793888 TGATTTGCCCTGAGAATACAGGG + Intronic
1185363582 22:50423840-50423862 AGAATTGCCCTGAAAGCAGAAGG + Intronic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
957190131 3:76997267-76997289 TAAATTGATCTGATAGTAGATGG + Intronic
960831122 3:121849580-121849602 TGCATTGCCTGAATAATAGAAGG - Intronic
963593555 3:147295969-147295991 TAAATTGCCTTAATAATAGCTGG + Intergenic
971078709 4:23181162-23181184 TTAATTTCCCTGATAAGTGAAGG - Intergenic
971865246 4:32161795-32161817 AGAATTGCACAGATAATGGAAGG - Intergenic
974020714 4:56689719-56689741 TCAAATGCCCTGATAGAAGAAGG + Intergenic
974146368 4:57953063-57953085 TGCTTTGCCCTGAACATAGAGGG - Intergenic
980452025 4:132986222-132986244 TGAATTTCTCTGATCATTGAGGG + Intergenic
981727865 4:147866740-147866762 TTCATGGCCCTGATGATAGAAGG - Exonic
984053711 4:174899291-174899313 TGAATTTCCCGCATCATAGAGGG - Intronic
984181711 4:176491153-176491175 TGAATGGCCCTAATTATACAGGG + Intergenic
986821952 5:11477178-11477200 TTAATTGCCGTGATAATTGTGGG - Intronic
987010070 5:13753900-13753922 TAAAGTGACCTGATAATAAAAGG + Intronic
987042329 5:14074690-14074712 TGATTTCTCCTGATAAAAGAAGG + Intergenic
990604006 5:57389330-57389352 TGCATTTCCCTGATGATATATGG + Intergenic
992999323 5:82364694-82364716 TGTATTTCCTTGAAAATAGATGG - Intronic
993329567 5:86580894-86580916 TGAATTGCCCTGCTAGTAAATGG - Intergenic
994777725 5:104056096-104056118 TGAATTTCCCTGATAATTAGTGG + Intergenic
995727415 5:115196034-115196056 TAAATTGCAGTGAAAATAGATGG + Intergenic
995963133 5:117869797-117869819 TGAAATTCCCTGATGATATATGG - Intergenic
997736238 5:136214573-136214595 TGAATATCACTGATCATAGAAGG - Intronic
1006085060 6:31589524-31589546 ACATTTGCCCTGGTAATAGACGG + Exonic
1007131506 6:39478833-39478855 TGCATTTCCCTGATAATTAATGG + Intronic
1008371591 6:50738136-50738158 TGAATCTCCTTCATAATAGAGGG - Intronic
1010305442 6:74316188-74316210 TGAATTGCCCGGAAAAGAAAGGG + Intergenic
1012140056 6:95615650-95615672 TGAATTGACCTTATAGTAGAAGG - Intergenic
1012762722 6:103321892-103321914 TGACTTCCACTGATAACAGAGGG - Intergenic
1014088897 6:117380377-117380399 TGAATTTTCCTGAAGATAGAAGG - Intronic
1014550378 6:122783448-122783470 TCAATTACCCTGATAATTTAAGG + Intronic
1016291497 6:142533211-142533233 TGAATTGACCCGATGACAGATGG - Intergenic
1017403915 6:154095832-154095854 TAAATTGCACTGAGAACAGATGG - Intronic
1021799874 7:24294612-24294634 TGGATTGACCTGAGAATAGGAGG + Intergenic
1022459585 7:30593002-30593024 TGAAGTGTCCTGAGAAGAGAAGG + Intergenic
1023274933 7:38508382-38508404 TGAATTGGCTTGTTAATATATGG + Intronic
1024787673 7:52926956-52926978 TTAATTGACCTGAAAATAAAGGG - Intergenic
1024872965 7:53987244-53987266 TGAATTCAACTGATGATAGATGG - Intergenic
1027804014 7:82792800-82792822 TGTATTGCCTTTATAATATATGG + Intronic
1028824861 7:95260021-95260043 TGAATTGCACTAATAATTAAAGG + Intronic
1031168098 7:118255124-118255146 TGAATTGTTATGGTAATAGAAGG + Intergenic
1032745346 7:134780756-134780778 TGCATAGTCCTGTTAATAGAAGG - Intronic
1033172341 7:139095289-139095311 TAAATTGCCGTGTTATTAGAGGG + Intronic
1035013348 7:155740645-155740667 TGTATTGCTCTGAAAATAAAAGG + Intronic
1041907798 8:63052702-63052724 TGGGTTCCCCTGATAATATATGG + Intronic
1041989946 8:63975001-63975023 TAGAGTGCCCTGGTAATAGAAGG + Intergenic
1042159406 8:65877245-65877267 TGCATAGCACTGATAATTGATGG - Intergenic
1042193645 8:66213094-66213116 TGACTTGCCCTGATAGTAAGTGG + Intergenic
1043206005 8:77441370-77441392 TGCATTTCCCTGATTATTGATGG + Intergenic
1043785702 8:84397133-84397155 TGATGTGCCTTGAAAATAGAGGG + Intronic
1044518320 8:93166387-93166409 TCAATTACTCTGATAAAAGAAGG + Intronic
1044931743 8:97258512-97258534 TGAATTGCCCTGTGCATAGAGGG + Intergenic
1046741146 8:117830324-117830346 TGAATAGACCTGATTGTAGAAGG + Exonic
1048767329 8:137859349-137859371 TGAACTGCTCTGATAAGAGAAGG + Intergenic
1055200307 9:73650585-73650607 TGAATTGCCCTGATGATTAGTGG - Intergenic
1056054367 9:82805724-82805746 TGAATTTCCATAATTATAGATGG - Intergenic
1203757506 Un_GL000218v1:147664-147686 TAAACTGCCCTGATCACAGAAGG - Intergenic
1203416785 Un_KI270330v1:613-635 TGAAATGCCCTGTGAATGGAAGG - Intergenic
1193230409 X:79038235-79038257 TGAATTTCTCTGATATTCGATGG + Intergenic
1196908324 X:120460646-120460668 TGTATTCACCTGATCATAGAAGG - Intronic
1197085767 X:122472988-122473010 TGAATTGCAGTGAAAATAGGAGG + Intergenic
1197087108 X:122491688-122491710 TGCATTTCCCTGATAATTAATGG + Intergenic
1199306694 X:146275408-146275430 TGAATAGCAGTGGTAATAGAGGG + Intergenic
1199926182 X:152466917-152466939 TGCATTTCCCTGATAATTGGTGG - Intergenic
1202043584 Y:20713555-20713577 TGCATAGCACTGATAATTGATGG + Intergenic