ID: 947000162

View in Genome Browser
Species Human (GRCh38)
Location 2:225445709-225445731
Sequence TGAGCAGCCCAATTTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947000162 Original CRISPR TGAGCAGCCCAATTTGGTGC TGG Intronic
900817035 1:4855923-4855945 TGAGCAGCCTCATCTGGTGAGGG - Intergenic
900833766 1:4984587-4984609 TGACCAGCCCAAGATGGTGATGG - Intergenic
901797007 1:11685468-11685490 TGAGCAGGCCCAGTGGGTGCTGG - Intronic
905965736 1:42093626-42093648 GTAGCAGTCCAATGTGGTGCAGG + Intergenic
906279324 1:44542802-44542824 TGGTCAGCCCAATTTGCTACAGG - Intronic
907181836 1:52577492-52577514 TAAGCAGCCAAATTTTGTCCAGG - Intergenic
908766363 1:67558350-67558372 TGGGAAGCCCAATATGTTGCAGG + Intergenic
912327579 1:108783127-108783149 TGATCTGCCCACTTTGGTGCTGG + Intronic
912455008 1:109791403-109791425 TGAGAAGACCAATTAGGGGCAGG - Intergenic
915218170 1:154353515-154353537 TGAGCAGGCTAATTTGGGGAAGG - Intergenic
917505470 1:175623435-175623457 TGGGCATCCCAATTTGTTGGAGG + Intronic
918198176 1:182242268-182242290 TGAACAGCACAATCTGATGCCGG + Intergenic
918663376 1:187117200-187117222 TGAGCAGACCAATTGGGGGGGGG + Intergenic
1067894672 10:50166015-50166037 TGTGCAGGCCAATTTTGCGCTGG + Intergenic
1067954169 10:50774247-50774269 TGTGCAGGCCAATTTTGCGCTGG - Intronic
1069708567 10:70474819-70474841 TGAGCATCCCCATCTGGCGCAGG - Intergenic
1073513246 10:104055845-104055867 TGTGCAGCCCAATTTTGTCCAGG + Exonic
1078054904 11:8000771-8000793 TGAGCAACTTATTTTGGTGCAGG - Exonic
1078639744 11:13083702-13083724 TGAGCAGCCCAAACAGGTCCAGG + Intergenic
1080267396 11:30415930-30415952 TGAGCAGCCTAATTGGGTGCAGG - Intronic
1081877254 11:46417344-46417366 TGAAAAGCTCAATTTGGGGCTGG - Intronic
1087235067 11:95708917-95708939 TGAGGAATCCAACTTGGTGCAGG - Intergenic
1089517831 11:119044990-119045012 AGAACTGCCCAATTTGCTGCAGG + Exonic
1092385640 12:8033686-8033708 TGAGCCTCCCAAGTTGGTGAGGG - Exonic
1094755360 12:33462771-33462793 AGGGCTGCCCAATTTTGTGCTGG - Intergenic
1103098563 12:118152334-118152356 TGAGCAGCTCCATTTCCTGCTGG + Exonic
1103315830 12:120054325-120054347 TCAGCCTCCCAAATTGGTGCTGG + Intronic
1104201229 12:126591290-126591312 TGAGCTGCTAAATTTGGGGCAGG - Intergenic
1112343449 13:98571279-98571301 TGAGCTGCCTAATGTGGTGCAGG - Intronic
1115343089 14:32312861-32312883 TGAGAGGCCCAAGTTGGTCCAGG - Intergenic
1116459252 14:45152670-45152692 TGAGCAGACCAATTTGGCTGAGG + Intronic
1121252589 14:92511072-92511094 TGAGCAGCCCCTTTTGGTTGTGG - Intergenic
1121871722 14:97414194-97414216 TTAGCATACCAATTAGGTGCTGG + Intergenic
1122092430 14:99349222-99349244 TGACCAGCCCTATGTGGGGCTGG - Intergenic
1122410818 14:101525407-101525429 AGAGGAGCCCAGCTTGGTGCCGG - Intergenic
1125509349 15:40284288-40284310 TGAGCCGCACATTTTGTTGCCGG + Intronic
1127899506 15:63330594-63330616 TGAGCAGCCCAGTCTGTGGCTGG + Intronic
1128357346 15:66937371-66937393 TGAGTAGCCCAACTTGGGTCAGG - Intergenic
1128916231 15:71565427-71565449 TGAGCAGCCTAATCTGATGTGGG - Intronic
1128948333 15:71847662-71847684 TGAGAGGCCCAATTTAGTGGTGG - Intronic
1130953241 15:88608930-88608952 TGAGTAGGACTATTTGGTGCAGG - Intergenic
1133341971 16:5042525-5042547 TGAGCAGCCCAGGTGGGTGGTGG - Intronic
1137785443 16:51134356-51134378 CGCGCAGCCCAAGGTGGTGCAGG + Intergenic
1140740745 16:77939013-77939035 TGAGCAGTCCAGGTTGATGCAGG - Intronic
1145263071 17:21366197-21366219 TGAGCTGCCAAATTTGGGGATGG + Intergenic
1152713654 17:81887714-81887736 GGAGCAGCCCCATCTGGTGTTGG - Intergenic
1152825830 17:82464101-82464123 TGAGCAGCTCAAGGTGGTGAAGG - Intronic
1153573330 18:6495360-6495382 CTAGCAGCCCCATTTGGTGGAGG + Intergenic
1154168378 18:12033084-12033106 TGAGCAGCCCATTTCGTTTCTGG - Intergenic
1158113333 18:53966284-53966306 GGAGCAGCCAAACTTGATGCAGG + Intergenic
1160128233 18:76199190-76199212 TGAGGGGCCAAATTTGGTGAGGG - Intergenic
1160418585 18:78728676-78728698 TGGGAAGCCCAATTTGAAGCTGG + Intergenic
1160782178 19:882741-882763 TGAGCTGCTCAGTTTGGGGCTGG + Intronic
1163558922 19:18007789-18007811 TGTCCAGCCCGATTTGGGGCGGG - Intronic
1168349159 19:55666185-55666207 TGACCAGGCCATCTTGGTGCAGG - Intronic
925427119 2:3759083-3759105 TGAACTGCACATTTTGGTGCTGG - Intronic
927691658 2:25212853-25212875 ACAGCAGCCCAATTTCATGCTGG + Intergenic
929160588 2:38828192-38828214 TGAGCAAACCTATTTGCTGCAGG - Intronic
930255635 2:49087022-49087044 TGAGCAGAGCAACTTGCTGCTGG - Intronic
932109263 2:68980078-68980100 TGTGCACCCCAAGTTAGTGCTGG + Intronic
933592536 2:84248658-84248680 TGAGCATCTCCATTTGGTGTTGG - Intergenic
935385665 2:102497526-102497548 TGAGTTGCCCAAGTTGTTGCAGG - Intronic
937149674 2:119677957-119677979 TGAGCAGCCAAAATTGGGGGGGG + Intergenic
942323992 2:174760049-174760071 TGAACAGCCAAAATTGATGCTGG + Intronic
947000162 2:225445709-225445731 TGAGCAGCCCAATTTGGTGCTGG + Intronic
948012956 2:234664595-234664617 TGAGGAGCCCATTTTGGGGAAGG + Intergenic
1169197574 20:3691768-3691790 TGAGAAGCCTAATCTGGTGGAGG - Intronic
1169967121 20:11230101-11230123 TAAGGAGAACAATTTGGTGCAGG + Intergenic
1173159294 20:40640234-40640256 TGAGTAGGCCACTGTGGTGCTGG - Intergenic
1174123092 20:48281890-48281912 TGAGCAGCCCAATTTTGTAAGGG + Intergenic
1174996709 20:55577883-55577905 TGAGCAGCTCCATCTGGTGAGGG + Intergenic
1181489684 22:23253860-23253882 AGGGCAGCCCATCTTGGTGCCGG - Exonic
1183190398 22:36318711-36318733 GGAGCAGGCCAACCTGGTGCTGG + Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
951630480 3:24714748-24714770 TCAGCAGAGTAATTTGGTGCTGG - Intergenic
951655698 3:25005662-25005684 GGATCAGCCCAATTTAGTGTGGG + Intergenic
954151948 3:48662307-48662329 TGAGCAGCCGAATGAGGAGCTGG - Exonic
955059410 3:55482968-55482990 TCAGCGGCCCAGATTGGTGCTGG + Intronic
955557599 3:60154883-60154905 TGAACAACCTAACTTGGTGCTGG - Intronic
957914266 3:86666719-86666741 TGAGTAGCCCAAATTTGAGCAGG - Intergenic
961828831 3:129612880-129612902 CGAGCCGCCCAAGTTGGAGCTGG + Intergenic
966144006 3:176789056-176789078 GGATCAGCCCAATTTGTTGTTGG - Intergenic
982279763 4:153671224-153671246 TCAGCATCCCAAGTAGGTGCAGG + Intergenic
988354285 5:30152590-30152612 TGAGCAGCCGCATCTGGTGAGGG + Intergenic
989487721 5:42011409-42011431 TGAGCAGCCACATCTGGTGAGGG - Intergenic
992084149 5:73262915-73262937 GGAGCAGCTCCATTTGGGGCAGG + Intergenic
992464389 5:76989236-76989258 TGATTTGCCCAAATTGGTGCTGG - Intergenic
1002826425 6:778123-778145 TGTGCAGCCAAATTTGGGGACGG + Intergenic
1003447714 6:6200059-6200081 TGACCAGCCCAATTCTGGGCAGG + Intronic
1006054909 6:31377221-31377243 TCAGCAGCCCAGAATGGTGCTGG + Intergenic
1006163280 6:32050121-32050143 TGGGCAGCCCAAGGCGGTGCGGG - Intronic
1006163904 6:32053511-32053533 TGGGCAGCCCAAGGTGGTGCGGG - Intronic
1006164532 6:32056709-32056731 TGGGCAGCCCAAGGCGGTGCGGG - Intronic
1010606800 6:77899951-77899973 TGATCAGCCCAATTTCATGAAGG - Intronic
1013097766 6:106961438-106961460 TGAGAAGCCCAGTTGGGTGTGGG - Intergenic
1016770060 6:147839189-147839211 TCAGGAGTCCAGTTTGGTGCAGG - Intergenic
1017527746 6:155256881-155256903 AGAGCAGCCCAAACTGGTCCGGG + Exonic
1026833255 7:73622878-73622900 TGAGCAGCCAAAGTTGGGGTTGG + Intronic
1031976908 7:128099890-128099912 TTATCAGGCCAAGTTGGTGCTGG + Intergenic
1043676374 8:82960821-82960843 TGCCCAGCTCATTTTGGTGCTGG + Intergenic
1049068371 8:140337672-140337694 TAGGCAGCCCATTTTGGTGGGGG - Intronic
1051039795 9:12793820-12793842 TGAGCAGTTCCATTTTGTGCAGG - Intronic
1051421922 9:16897276-16897298 TGATCTGCCCATCTTGGTGCTGG + Intergenic
1057277760 9:93685034-93685056 GGAGCAGCCCACTGCGGTGCTGG + Intergenic
1059361463 9:113745085-113745107 TCAGCTGCCCATGTTGGTGCAGG + Intergenic
1061013926 9:127971226-127971248 TGAGCAGCCCTGTTTGATGGAGG + Intronic
1061890521 9:133616861-133616883 TGAGCTGCCCACAGTGGTGCAGG + Intergenic
1187960446 X:24562419-24562441 TGAGCAGCCCAACCCGGAGCCGG - Exonic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1192605157 X:72508783-72508805 TGAGGAGCCACATTTGGTGAAGG - Intronic
1197984805 X:132256126-132256148 TGAGCAGGGCAAGTTGGTGGAGG - Intergenic
1200060509 X:153481729-153481751 TGAGCAGCCCTGTCTGGTGTGGG + Intronic