ID: 947000875

View in Genome Browser
Species Human (GRCh38)
Location 2:225454776-225454798
Sequence CTTTTTCCACAGATGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 25, 3: 153, 4: 486}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947000875_947000885 18 Left 947000875 2:225454776-225454798 CCCCTCCCCATCTGTGGAAAAAG 0: 1
1: 0
2: 25
3: 153
4: 486
Right 947000885 2:225454817-225454839 TCCCTGGTGCCAAAAAGTTTGGG 0: 92
1: 1191
2: 1775
3: 1334
4: 906
947000875_947000884 17 Left 947000875 2:225454776-225454798 CCCCTCCCCATCTGTGGAAAAAG 0: 1
1: 0
2: 25
3: 153
4: 486
Right 947000884 2:225454816-225454838 GTCCCTGGTGCCAAAAAGTTTGG 0: 113
1: 1184
2: 1829
3: 1368
4: 871
947000875_947000881 2 Left 947000875 2:225454776-225454798 CCCCTCCCCATCTGTGGAAAAAG 0: 1
1: 0
2: 25
3: 153
4: 486
Right 947000881 2:225454801-225454823 TCTTCCGCGAAACCAGTCCCTGG 0: 5
1: 128
2: 841
3: 1165
4: 1534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947000875 Original CRISPR CTTTTTCCACAGATGGGGAG GGG (reversed) Intronic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
901714232 1:11140295-11140317 ATTATTCCACAGATTGGGTGGGG + Intronic
902600078 1:17534967-17534989 ATTTTTCCATGGATGGGGTGGGG + Intergenic
903285319 1:22273364-22273386 CATTTTCAACACTTGGGGAGGGG - Intergenic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
904587119 1:31586698-31586720 CTCTGCCCACAGATGGGGAGAGG + Exonic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
907366761 1:53967653-53967675 CTTCTGTCACAGATGGGAAGCGG + Exonic
907597708 1:55734954-55734976 ATTTTTACAAAGATGGAGAGAGG - Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
908292948 1:62686947-62686969 TTTTTTGCAGAGATGGGGTGGGG + Intronic
908405937 1:63814415-63814437 GTTCTTCCACCGATGGGGTGGGG + Intronic
910977143 1:92918757-92918779 GTTTTGCAACAGATGGGGTGGGG + Intronic
911363049 1:96903096-96903118 AGTTTTCCACAGATGGACAGTGG + Intergenic
913451365 1:118994833-118994855 CTATTTCCACTGGTGGAGAGGGG - Intergenic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
915205799 1:154269605-154269627 TGTTTTCCACAGCTGGGGAAGGG - Intronic
915471103 1:156126345-156126367 CTTCTCCCCCAGATTGGGAGAGG + Intronic
915564160 1:156704783-156704805 CTTGTCTCACAGATGGGGGGTGG + Intronic
916629913 1:166601224-166601246 GTTTTTCCACAGACTGGTAGGGG + Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
918460141 1:184767995-184768017 TTTTTTCCACGGATGGGGCAGGG - Intergenic
919996567 1:202757052-202757074 ATTTTTCCATGGATGGGGAAGGG + Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921456275 1:215375974-215375996 TTTTTTTCACAGAATGGGAGAGG + Intergenic
921566809 1:216731348-216731370 ATTTTTCCTCTTATGGGGAGAGG + Intronic
921868926 1:220116378-220116400 TGTTTTTCACAGATGTGGAGAGG + Intronic
922607852 1:226902095-226902117 GTTTTTCCACAGATAGGGGTTGG + Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
923512556 1:234665002-234665024 ATTTTTCCACGGTTGGGGGGTGG - Intergenic
923616745 1:235544655-235544677 TTTTTTCCACAGATGTGGGGTGG - Intergenic
924349462 1:243101138-243101160 TTTTTTCTAGAGATGGGGTGGGG - Intergenic
1063594420 10:7420901-7420923 ATTTTTCCATGGATGGGCAGTGG - Intergenic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064310394 10:14207288-14207310 ATTTTTCCACGGATGGGGGTGGG + Intronic
1064330347 10:14388144-14388166 CTCTGTGCACAGATGAGGAGAGG - Intronic
1064558222 10:16568721-16568743 CTTTTTCCACAGACTGTGGGTGG - Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1065960241 10:30728003-30728025 ATTTTTCCATGGATGGGGAGAGG + Intergenic
1066199465 10:33131279-33131301 ATTTTTCCACAGAGAGGGACAGG + Intergenic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1067844949 10:49712295-49712317 TTTTCTCCATAGATGGGGGGAGG - Intergenic
1067921484 10:50462920-50462942 CTGGTTCCTCAGAAGGGGAGTGG + Intronic
1068194129 10:53694379-53694401 TTTTTTCCACAGACGGGGGTAGG + Intergenic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069280176 10:66645820-66645842 ATTTTTCCACGGATAGTGAGTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069605067 10:69733700-69733722 ATTTTTCCATAGACGGGGTGGGG - Intergenic
1069857413 10:71448930-71448952 CTTTTTCCTGCCATGGGGAGTGG + Intronic
1069896470 10:71683249-71683271 TGTCTCCCACAGATGGGGAGGGG - Intronic
1070025412 10:72627033-72627055 CTATTTCCACAGCAGGGGTGAGG - Intergenic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1071479018 10:86049057-86049079 CCTGTTTCACAGATGAGGAGAGG + Intronic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1075290149 10:121222361-121222383 ATTTTTCCACGGATGTGGAGTGG - Intergenic
1076854226 10:133108053-133108075 CTTTCTCCACATGTGAGGAGTGG + Intronic
1078099629 11:8322319-8322341 GTTTTTCCACAGATCGGGTAGGG - Intergenic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1081325268 11:41737005-41737027 CAGTTTCCACACATGGTGAGAGG - Intergenic
1081910139 11:46695212-46695234 CTCTTTCCAAAAATGGGGAGGGG - Intronic
1081945685 11:46991681-46991703 CTTGTAACAGAGATGGGGAGGGG - Intronic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083939135 11:65885811-65885833 CTCTTCGCACAGATGGGGAAGGG - Intronic
1084932356 11:72567112-72567134 ATTTTTCCACGGACGAGGAGTGG + Intergenic
1085110028 11:73879692-73879714 TTTTTTATAGAGATGGGGAGGGG - Intronic
1086359670 11:86044898-86044920 GTTTTTCCACAGACTGGCAGGGG - Intronic
1086372109 11:86165181-86165203 CTTTAGCCCCAGATGGGCAGTGG + Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1088185713 11:107166864-107166886 CTTTTTCCACAGATGTGGTCAGG + Intergenic
1088736291 11:112730382-112730404 ATTTTTCCACTAATGGGGTGGGG - Intergenic
1089730479 11:120515938-120515960 CCTTTTCCACAGATGAGGAAGGG + Intronic
1090557521 11:127892517-127892539 CTTTTTACAAAAATGGGGAGTGG - Intergenic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1091335309 11:134762112-134762134 CTGCTCCCACAGCTGGGGAGTGG - Intergenic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1091793264 12:3283447-3283469 CTTTGTCCCCACATGGGGTGGGG + Exonic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1092045987 12:5432211-5432233 CTTTTTCCCCTGCTGGGTAGTGG + Exonic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093399023 12:18720553-18720575 CCCATTCCACAGATAGGGAGAGG - Intronic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093661967 12:21767580-21767602 ATTTTTCCACTGATGGGGGTGGG - Intronic
1093766840 12:22973513-22973535 ATTTTTCCACAGATGAGGGTGGG + Intergenic
1094164973 12:27434723-27434745 CTATTTCCATAGCTGGGGAATGG - Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1094747644 12:33364114-33364136 ATTTTTCCACAGACTGGGATGGG - Intergenic
1095184064 12:39180425-39180447 ATTTTTCCATGGATGGGGAGGGG + Intergenic
1095184370 12:39184722-39184744 ATTTTTTCACGGATGGGGGGTGG - Intergenic
1095322662 12:40847834-40847856 GTTTTTCCACGGATGGGGTGAGG + Intronic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095582146 12:43812834-43812856 CTTTTTGTAGAGATGGGGAGTGG - Intergenic
1096561279 12:52437703-52437725 CCTCTTCCACAGATGAGGAGTGG + Intergenic
1097447420 12:59689379-59689401 CTTCTGCCTCAGGTGGGGAGAGG + Exonic
1097728995 12:63106502-63106524 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1098125738 12:67291018-67291040 ATTTTTCCACAGATTTGCAGGGG - Intronic
1098140465 12:67445446-67445468 ATTTTTCCACTGATGGGCAAGGG + Intergenic
1099222240 12:79929050-79929072 ATTTTTCCACAGATGTGGGTTGG + Intronic
1099306399 12:80961690-80961712 GTTTTTGCACAGAAAGGGAGAGG + Intronic
1099863531 12:88249349-88249371 ATTTTTCCACAGACGGGTTGGGG - Intergenic
1100220968 12:92504320-92504342 CTTTTGTCACTGATGGGGAGGGG + Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101293627 12:103397582-103397604 ATTTTTCCACAGACAAGGAGGGG - Intronic
1101693187 12:107100123-107100145 CTTCTTCCACAGAGGGGTAGGGG + Intergenic
1102514037 12:113434717-113434739 CTCTTTGCAAAGTTGGGGAGGGG + Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102652200 12:114449869-114449891 CCTTTTCTCCAGATGGGGGGAGG - Intergenic
1103226375 12:119291520-119291542 ATTTTTCCACAGACGGGGTCAGG - Intergenic
1103544306 12:121688843-121688865 CTATGTCCACAGCTGGGAAGGGG - Intergenic
1103888089 12:124217644-124217666 CTGTTTCCAGAGCTGGGGTGCGG - Intronic
1104722191 12:131050737-131050759 ATTTTTGCACGGATGGGGTGGGG + Intronic
1104833487 12:131771321-131771343 CATTTCCCACAGCAGGGGAGGGG - Intronic
1104896159 12:132165840-132165862 GTCTGTGCACAGATGGGGAGAGG + Intergenic
1105842737 13:24269203-24269225 CTCTTTCCACATCTGCGGAGTGG - Intronic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1107797184 13:44064848-44064870 ATTTTTCCATGGATTGGGAGGGG + Intergenic
1107936500 13:45349785-45349807 TTTTTCCTACTGATGGGGAGTGG - Intergenic
1108597277 13:51960383-51960405 CTGTGTCCTCAGAAGGGGAGTGG - Intronic
1109766109 13:66900266-66900288 CTTATTCTACAGATGGGAAAAGG - Intronic
1110105461 13:71669570-71669592 TTTTTTCCACTGATGGGGGTGGG - Intronic
1110909038 13:80932423-80932445 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1111320964 13:86628359-86628381 ATTTTTCCATGGATGGTGAGTGG + Intergenic
1111964242 13:94845235-94845257 CATATTCCACAGAAGGGCAGTGG + Intergenic
1113265952 13:108618211-108618233 CTCTTGCAGCAGATGGGGAGTGG - Intronic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114897138 14:27005020-27005042 ATTTTTCCACGGATGGGGTGAGG - Intergenic
1114977586 14:28121488-28121510 GTTTTTCAAGAGATGGGGTGGGG + Intergenic
1115059405 14:29171526-29171548 CTTTTTCCACATATGGTCAAAGG - Intergenic
1115308605 14:31957279-31957301 GATTTTCCACAGACAGGGAGTGG - Intergenic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1116423756 14:44764794-44764816 ATTTTTCCACAGATCAGGGGTGG - Intergenic
1117281145 14:54242261-54242283 ATTTTTCCACAGACTGGCAGGGG + Intergenic
1117531539 14:56664902-56664924 CTTTTTTCAGAGACAGGGAGTGG - Intronic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1118056855 14:62087821-62087843 ATTTTACCTCAGAAGGGGAGGGG - Intronic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119198257 14:72733337-72733359 CTATTTACAGAGATGGGGAGAGG + Intronic
1119946782 14:78703741-78703763 CATTCTCCACTGATGTGGAGTGG + Intronic
1120428435 14:84381361-84381383 ATTTTTCCACGGATGGGGATGGG + Intergenic
1120859477 14:89241897-89241919 CTTTCTCCATGGGTGGGGAGAGG - Intronic
1120924338 14:89782784-89782806 ATTTTTCCACAGATGAGATGGGG + Intergenic
1120988534 14:90354964-90354986 ATTTTTCCACGGATGGGGAGGGG + Intergenic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1122170001 14:99864978-99865000 ATTTTTCCACAGAAGTGGGGCGG + Intronic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1122960226 14:105090813-105090835 CTGTTTCCTCATCTGGGGAGTGG - Intergenic
1123009398 14:105340440-105340462 GTTTTTCCACAGACGGTGATGGG + Intronic
1124462146 15:29902069-29902091 CTATTTCCACAAATTGGAAGAGG + Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1126037985 15:44565330-44565352 ATTTTTCCACAGACTGGGAGGGG + Intronic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1126399575 15:48255799-48255821 CTTTATCCACAGATGTGAACTGG + Exonic
1126739064 15:51759793-51759815 CTATTTACAAAGATGGGGGGAGG + Intronic
1127159332 15:56164978-56165000 ATTTTTCCATGGATGGGGTGGGG + Intronic
1127994582 15:64145781-64145803 TTCTTTCCCCAGATGGGCAGGGG + Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128652994 15:69433625-69433647 ATTTTTACACAGATGGGTTGAGG - Intronic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1132032118 15:98446852-98446874 GTTTTTCCACGGATGGGGCAGGG - Intronic
1132050305 15:98602210-98602232 GTTTTTCCACAGATGTGGTGTGG - Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1132198457 15:99931668-99931690 GTGTTTCCATAGATGGAGAGTGG + Intergenic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134286639 16:12867688-12867710 TTTTTTGCAGAGATGGGGGGGGG + Intergenic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1137366452 16:47863649-47863671 ATTTCTACACAGATGGGGAGTGG + Intergenic
1137674393 16:50297103-50297125 CCTATTGCACAGATGGGGAAAGG + Intronic
1138194076 16:55039853-55039875 CTGATTCCACAGATGTAGAGGGG - Intergenic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1139722606 16:68868859-68868881 CCTCTTCCACACATGGTGAGAGG - Intronic
1139953200 16:70681698-70681720 CTGTTTCCCCAGGAGGGGAGGGG - Intronic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1140275387 16:73504178-73504200 TTCTTTCCAAAGCTGGGGAGTGG - Intergenic
1140358621 16:74326400-74326422 ATTTTTCCGCAGATTGGGACGGG + Intergenic
1140522905 16:75597510-75597532 ATTTTTCCACAGATCCGGGGTGG + Intronic
1141881885 16:86865722-86865744 CTAATTCCACAGATGAGGAAAGG - Intergenic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1142824934 17:2504172-2504194 TTTATTACACAGATGGAGAGTGG + Intronic
1144450143 17:15370387-15370409 ATTTTTCCACGAATGGGGAGTGG + Intergenic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1146253956 17:31378110-31378132 CTTTCTCCACTGATTGGGGGAGG - Intronic
1146935559 17:36810677-36810699 CTTTTTCCCCAGGTGGGAAGTGG + Intergenic
1147144729 17:38478360-38478382 CTTTGGCCACAGGTGGGCAGGGG + Intronic
1147412405 17:40263195-40263217 ATTTTTCCATAGATGGTGGGCGG + Intronic
1147448967 17:40491942-40491964 CCTGTTCCAAAGATGGGGTGCGG + Intronic
1147642555 17:42012976-42012998 TTTTTTACAGAGATGGGGGGCGG + Intronic
1147782107 17:42950801-42950823 CTTTTTCCAGGGACTGGGAGAGG + Intronic
1148029003 17:44607289-44607311 CTTTATCCACAGATGGGCATTGG - Intergenic
1149140067 17:53421580-53421602 TTTTTTCCACAGACTGGGGGAGG - Intergenic
1149588285 17:57808337-57808359 GTTTTTCCATGGATGGGGATGGG - Intergenic
1149786558 17:59440465-59440487 CTTTTTGTAGAGATGGGGAGGGG - Intergenic
1150290189 17:63976671-63976693 GTCTGTTCACAGATGGGGAGAGG - Intergenic
1150379551 17:64709823-64709845 CTAATACCACAGATGGGGAAGGG - Intergenic
1151279525 17:73062729-73062751 GTTTTTCCACGGATTGGGGGTGG + Intronic
1151626286 17:75277826-75277848 CTTTTTCCAGGCAGGGGGAGTGG - Intronic
1151958962 17:77394984-77395006 GTTTTTCCAGAGGTGGGGATGGG + Intronic
1153677095 18:7465495-7465517 TTTTCTCCACAGATGGGGGGAGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1153912209 18:9714239-9714261 ATTTTTCCACAGATGGGAGCAGG + Intronic
1154045628 18:10902202-10902224 ATTTTTCCACGGATGGGGGTAGG - Intronic
1154236240 18:12608955-12608977 ATTTTTCCACAAATGGGGGTGGG + Intronic
1155320182 18:24611470-24611492 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1157297981 18:46459612-46459634 CTTCCCCCACAGATGGGGACAGG + Exonic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1157482175 18:48062281-48062303 CTTGATCCCCAGAAGGGGAGAGG + Intronic
1157513848 18:48297040-48297062 AATTTTCCACAGACGGGGTGGGG - Intronic
1157833102 18:50875552-50875574 TTTTTGCCACAGATGTGTAGTGG - Intergenic
1158014438 18:52766887-52766909 CTTTTACCATTGATGGGGACAGG - Intronic
1158862893 18:61610378-61610400 ACTTTTCCACAGACGCGGAGGGG + Intergenic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1159021773 18:63149190-63149212 ATTTTTCCACGAATGGGGTGGGG + Intronic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1160334259 18:78023490-78023512 ATTTTTCCACAGACTGGGAGCGG + Intergenic
1160727554 19:624262-624284 ACTCATCCACAGATGGGGAGGGG + Intronic
1161204461 19:3033838-3033860 CTTTTTGTAGAGATGGGGGGTGG - Intronic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1163414940 19:17180743-17180765 CTTTTGCCAGAAATGGGGACTGG - Intronic
1163506695 19:17711609-17711631 GTTTTTACACAGAAGGGCAGAGG - Intergenic
1163938427 19:20471562-20471584 ATTTGTGCACAGATGAGGAGAGG + Intergenic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1165210321 19:34230704-34230726 GTTTTTCCACAGATGAGCAGGGG + Intergenic
1165242478 19:34479903-34479925 ATTTTTCCACAGACAGGGATGGG - Intergenic
1165271036 19:34707877-34707899 TTGTTTCCACAGAGTGGGAGGGG - Intergenic
1165385705 19:35509679-35509701 CTTATACCACAGATGGGGCTGGG - Intronic
1166018317 19:40000805-40000827 GTTTTTTCACAGACAGGGAGAGG + Intronic
1166121816 19:40691065-40691087 CTTTTTGCAAGGAAGGGGAGGGG + Intergenic
1166265667 19:41682722-41682744 CTTTTTCCCCAGATGAGAGGAGG - Intronic
1166612886 19:44215068-44215090 ATTTTTCCACGGATGGGGGCGGG - Intronic
1166940276 19:46358917-46358939 GTTTTTCTCAAGATGGGGAGTGG + Intronic
1167636847 19:50660151-50660173 CTTTACCCACAGCAGGGGAGGGG + Intronic
1168434275 19:56304854-56304876 CTTTTCCCACCGCTGGGGTGGGG + Intronic
925007077 2:451923-451945 GTTTTTCCACGGATGGGATGGGG + Intergenic
926286547 2:11493292-11493314 ATTTTTCCACAGACAGGGTGTGG + Intergenic
926903595 2:17785150-17785172 GTTTTTCCACGGATGATGAGGGG - Exonic
927246585 2:20961502-20961524 GTTTTTCCACAGTTGGGTAGAGG - Intergenic
927259452 2:21072449-21072471 GTTTTTCCACGGATGGGGATCGG + Intergenic
927864684 2:26580880-26580902 CTTCTCCCTCAGAAGGGGAGTGG + Intergenic
927932328 2:27053038-27053060 CTTTGTCCAGTGATGGGGAAGGG + Exonic
928245884 2:29626645-29626667 CTGTGTCCTCACATGGGGAGGGG - Intronic
928675259 2:33644670-33644692 ATTTTTCCACAGACTGGGAGTGG - Intergenic
929334498 2:40724436-40724458 ATTTTTCCACAGACCAGGAGTGG - Intergenic
929580402 2:43078630-43078652 CTTTTCCCAATGATGTGGAGAGG + Intergenic
931542244 2:63342005-63342027 ATTTTTCCATGGATGGGGTGGGG + Intronic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933733373 2:85475490-85475512 CGTTGTCAACAGATGGGGAAGGG + Intergenic
933776383 2:85773646-85773668 CTTTTTCCACTGCTGGGGTGAGG - Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935433121 2:102999385-102999407 ATTTTTCCACAGATGAGGTGTGG - Intergenic
936604981 2:113942720-113942742 CATTTTACACAAATAGGGAGGGG - Intronic
937167202 2:119831042-119831064 ATTTTTCCATGGATGGGGGGTGG + Intronic
937286782 2:120758847-120758869 CTCGTTGCACAGAAGGGGAGGGG + Intronic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
937524301 2:122748300-122748322 CTTTTACCAGAGAAGAGGAGGGG + Intergenic
937850333 2:126626679-126626701 ATTTTTCCACAGACTGGGTGGGG + Intergenic
938985373 2:136570414-136570436 GTTTTTCCACAGATGTGGATGGG + Intergenic
939370428 2:141292236-141292258 ATTTTTCCACAGACCGGGATGGG - Intronic
940039468 2:149345102-149345124 CTTTTTTCAGAGATGGGGTCGGG - Intronic
940453269 2:153867539-153867561 ATTTTTCCACAGACTGGGAGAGG + Intergenic
941184617 2:162306078-162306100 CTTTTGGCAGAGAAGGGGAGAGG + Intronic
941225569 2:162842714-162842736 CTTTTTCTATAGATGGGGTCTGG + Intergenic
941230340 2:162904088-162904110 GTTTTTCCACCAATGGCGAGCGG - Intergenic
941367308 2:164623102-164623124 ATTTTTCCACGGATGGGGTGGGG - Intergenic
942003415 2:171673772-171673794 CTTTTTTCACATCTGGGGATAGG - Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
943074884 2:183181854-183181876 CTTTTTCAACAAATGTGGTGAGG - Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
943885536 2:193212343-193212365 CTTTATCCAAAGAAGGGGAAAGG + Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944293111 2:198030430-198030452 GTTTTTCCACAGTTGGGGAAAGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946649472 2:221875250-221875272 ATTTTTCCACGGATGGGGGTAGG - Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947482410 2:230512658-230512680 GTTTTTCCACAGACCGGGATGGG + Intronic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
1168951276 20:1803600-1803622 CTTCTTCCCCACCTGGGGAGCGG + Intergenic
1168966105 20:1898951-1898973 CCTTTGCGACAGATGGAGAGGGG + Intronic
1169322050 20:4640987-4641009 ACTTTTCCACAGATGGGTGGGGG - Intergenic
1169514281 20:6299121-6299143 CTATTACCAAAGATAGGGAGAGG + Intergenic
1170187035 20:13602591-13602613 ATTTTTCCATGGATGGGGTGGGG + Intronic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1173121818 20:40299586-40299608 TTTTTTCCACACTTGGAGAGAGG + Intergenic
1173672100 20:44805930-44805952 CTCTGTCCAAAAATGGGGAGCGG + Intronic
1173838251 20:46139507-46139529 CTCCTTCCTCAGAAGGGGAGAGG - Intergenic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174387630 20:50196824-50196846 CATTTTCCCCATCTGGGGAGGGG - Intergenic
1174428903 20:50453472-50453494 CTTTTGCCACATATGGGCAGAGG + Intergenic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1175317900 20:58064549-58064571 CTTGTTCCACAGTTGGGGATCGG + Intergenic
1175486051 20:59347116-59347138 CTTTATCCATAGATTGGGAGAGG - Intergenic
1175637291 20:60596493-60596515 CTTTTTCCATAGCAGGAGAGGGG - Intergenic
1177131124 21:17256996-17257018 TTTTTTGCACAGAATGGGAGAGG + Intergenic
1177805208 21:25868533-25868555 ATTTTTCCACAGACCAGGAGTGG + Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1178462413 21:32815065-32815087 ATTTTTCCACAGACAGGCAGGGG - Intergenic
1178475030 21:32930534-32930556 ATTTTTCCATGGATGGGGTGCGG + Intergenic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180938513 22:19641716-19641738 ATTTTTCCACCGATGGGGTTGGG - Intergenic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1182635597 22:31724308-31724330 GTTTTTCCACAGATCTGGTGGGG - Intronic
1183284251 22:36952490-36952512 CCCTGGCCACAGATGGGGAGTGG - Intergenic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1184142491 22:42586005-42586027 GTTTTTCCTTAGATGGGGAGGGG + Intronic
1184198369 22:42947435-42947457 CTTTGTCCACAAAAGAGGAGCGG + Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
949186940 3:1203246-1203268 CTTTTCTCACAGATGGGGGCAGG - Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949762723 3:7488931-7488953 CTTTTTACATAGATGGTGACAGG + Intronic
950191517 3:10979966-10979988 CATTTTGCAGAGATGGGGTGGGG + Intergenic
950408586 3:12819951-12819973 ACTTTCCCAGAGATGGGGAGGGG + Intronic
950952825 3:17018537-17018559 TTTTTTCAACAGATGGGGCCTGG + Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
951668134 3:25149744-25149766 CATTTAACAAAGATGGGGAGAGG - Intergenic
952375596 3:32764670-32764692 CTTTTTCCCCAGCTGGTAAGCGG + Exonic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
952573474 3:34745594-34745616 CTATTGCCACAGATGGGCATGGG + Intergenic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953667929 3:44939498-44939520 TTTGTTCCCCAGATGGGAAGGGG - Intronic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
954725032 3:52601309-52601331 ATTTTTCCACAGACAGGGATGGG + Intronic
955913033 3:63877922-63877944 CTTTTTCCACAGGAGAGGACTGG - Intronic
956298244 3:67738227-67738249 CTTTTTCCACAGATGGGCTGGGG + Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
958816457 3:98921688-98921710 CTTATTTCACAGATGAGGAATGG + Intergenic
958822844 3:98995577-98995599 GTTTTTCCACAGGAGGGGAAGGG + Intergenic
958833111 3:99113623-99113645 CTTTTTCAACGGATGAGGAAAGG + Intergenic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
959531013 3:107433538-107433560 CTTTTTGCAGAGATAGGGTGGGG - Intergenic
959729307 3:109582686-109582708 TTTTTTAAAGAGATGGGGAGTGG + Intergenic
959789032 3:110334712-110334734 CTTTTTTCTCAGAGGGAGAGTGG - Intergenic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
960960199 3:123065356-123065378 AGTTTTCCACAGATGGTGGGGGG + Intergenic
961199629 3:125033969-125033991 ATTTTTCCACGGATAGGGCGGGG - Intronic
961230559 3:125303788-125303810 GTTTTTCCACGAATGGGGTGGGG - Intronic
961488775 3:127236253-127236275 AATTTTCCACAGATGAGGGGAGG - Intergenic
961646578 3:128395894-128395916 TTTTTTCCTCAGTTGGGGTGAGG - Intronic
961764238 3:129196074-129196096 CTTTCTCCCCTGATGGGAAGTGG + Intergenic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
962574628 3:136745439-136745461 ATTTTTCCACGGATGGGGTGGGG + Intronic
962808658 3:138944578-138944600 TTTTTTCTTCAGATAGGGAGAGG + Exonic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
963064348 3:141251824-141251846 CTATTTCTAGAGTTGGGGAGAGG + Intronic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
963624817 3:147658246-147658268 ATTTTTCCACAGACCTGGAGTGG + Intergenic
963699167 3:148602182-148602204 CTTTTTCTACTGCTGGGGAAAGG - Intergenic
964191972 3:154013641-154013663 CTTTTTGCAAAGAAAGGGAGTGG - Intergenic
964209624 3:154212579-154212601 ATTTTTCCACAGACGGGTGGGGG + Intronic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
965659776 3:171029053-171029075 CTTCTTCCATAAATGAGGAGGGG + Intergenic
966158696 3:176945857-176945879 TTTTTTCCATGGATGGGGGGTGG - Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
968963456 4:3757538-3757560 CTTTGGCCACAGCTGGGGACAGG + Intergenic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
970038807 4:11772501-11772523 ATTTTTCCACAGACTGGGATGGG + Intergenic
970690395 4:18612965-18612987 ATTTTTCCACAGATGAGGGTTGG + Intergenic
971879476 4:32351559-32351581 AGTTTTCCACAGATGGGCAGAGG + Intergenic
972633603 4:40863009-40863031 CTGTTTCCAGAGAAGGGGACTGG + Intronic
972670444 4:41209937-41209959 ATTTTTCCACGGATGGGGTTGGG + Intronic
973095968 4:46200177-46200199 GTTTTTCCACAGATGTTGGGTGG - Intergenic
973117467 4:46478878-46478900 ATTTTTCCACGGACGGGGATGGG - Intergenic
973212458 4:47631672-47631694 ATTTTTCCACAGACTGGGATGGG - Intronic
975646952 4:76555176-76555198 ATTTTTCCACGGATGGGGTGTGG - Intronic
976104883 4:81605982-81606004 CATTTTCCAGAGATCTGGAGAGG - Intronic
976342349 4:83959249-83959271 ATTTTTCCACAGACAGGGAGTGG + Intergenic
976398952 4:84586214-84586236 TTTTTTCCACGGATGGGTTGGGG + Intronic
976674596 4:87690562-87690584 ATTTTTCCATGGATGGGGTGAGG - Intergenic
976942407 4:90719466-90719488 ATTTTTCCACAAAGTGGGAGGGG - Intronic
977775438 4:100914079-100914101 TTTTTTCCACAGACTGGGGGAGG - Intergenic
977923585 4:102672852-102672874 GTTTTTCTACAGATTGGGGGTGG - Intronic
978674025 4:111288066-111288088 CTTTTACCATAGCTGGGGAATGG - Intergenic
978742831 4:112157239-112157261 CTTTTTCCACAGGCAGAGAGAGG + Intronic
978754473 4:112287076-112287098 CTTTTTCCACAGACTGGGGTTGG + Intronic
979253909 4:118592365-118592387 TTTTTTCTAGAGATGGGGTGGGG + Intergenic
979335074 4:119453978-119454000 TTTTTTCTAGAGATGGGGTGGGG - Intergenic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
979651467 4:123136964-123136986 ATTTTTCCACAGGTGTGGGGCGG + Intronic
979661519 4:123261088-123261110 ATTTTTCCACAAATGGGGTGGGG - Intronic
979791012 4:124781128-124781150 ATTTTTCCACAGACTGGCAGTGG - Intergenic
979996081 4:127432593-127432615 TCTTTTCCACAAATGAGGAGGGG + Intergenic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
980627295 4:135390256-135390278 GTTTTTCCATGGATGGTGAGGGG + Intergenic
980909071 4:138977582-138977604 GTTTTTCAACACATGTGGAGTGG - Intergenic
980910860 4:138993108-138993130 ATTTTTCCACGGACGGGGTGGGG - Intergenic
981104626 4:140866433-140866455 CTTTTCCCACACATAGAGAGTGG + Exonic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983251818 4:165354241-165354263 ATTTTTTCACAGACGGGGTGGGG + Intergenic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
984364929 4:178786273-178786295 ATTTTTCCATGGATGGGGGGTGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984736082 4:183109453-183109475 ATTTTTCCACAGAATGGGATTGG + Intronic
985394676 4:189530047-189530069 CTATTTCCAGAGGTGGGTAGAGG + Intergenic
985530012 5:428583-428605 ATTTTTCCACAGACTGGGAGTGG + Intronic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986006175 5:3670979-3671001 CTGTATCCACATATGGGGAGGGG - Intergenic
986418882 5:7556876-7556898 ATTTTTCCACGGATGAGGTGGGG - Intronic
986757394 5:10851048-10851070 ATTTTCCCACCTATGGGGAGTGG - Intergenic
987012869 5:13784966-13784988 ATTTTTCCACGGATGGGACGGGG + Intronic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987587197 5:19871068-19871090 TTTTATCCACAGATGTGCAGAGG + Intronic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988440644 5:31228584-31228606 ATTTTTCCACAGATGTGGTGGGG + Intronic
988626143 5:32876760-32876782 ATTTTTCCGCGGATGGGGATGGG - Intergenic
988705135 5:33718562-33718584 TTTTTTCCACGGACTGGGAGGGG - Intronic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
989566752 5:42908894-42908916 ATTTTTCTACGGATGGAGAGGGG + Intergenic
989707604 5:44356188-44356210 CTTTTCCCACTGAAAGGGAGTGG + Intronic
990468859 5:56094871-56094893 GTTTTTCCACGGACGGGGTGCGG + Intergenic
990972147 5:61519804-61519826 GTTTTTCCACGGATGGGGGGTGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991215132 5:64151434-64151456 CTTTGTTGGCAGATGGGGAGGGG - Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992212921 5:74497825-74497847 CTAAGTTCACAGATGGGGAGGGG - Intergenic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
993019762 5:82577526-82577548 TTTTTTGCACATCTGGGGAGTGG + Intergenic
993284440 5:85973357-85973379 CTGTGTCCTCACATGGGGAGGGG - Intergenic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
993770542 5:91919273-91919295 TTTTTTCCACAGACTGGGTGGGG + Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994323045 5:98415193-98415215 GTCTTTCTACAGATGAGGAGGGG + Intergenic
994708876 5:103241528-103241550 ATTTTTCCACAGATGAGGTGTGG - Intergenic
994938216 5:106284378-106284400 ATTTTTCCACGGATGGGGTAGGG + Intergenic
994952004 5:106475433-106475455 AATTTTCCACTGATGGGGTGTGG - Intergenic
995354429 5:111222715-111222737 TTTTTTCCACAGACAGGGGGTGG - Intergenic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996558603 5:124804258-124804280 GTTTTTCCACAGGTAGGGGGAGG - Intergenic
996808695 5:127488865-127488887 ATTTTTCCATGGATGGGGATGGG + Intergenic
997354016 5:133250801-133250823 CTTCTTCCACAGATGCTGAGTGG + Intronic
997358442 5:133279405-133279427 GTTTTTCCACAGACTGGGAGTGG - Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998109042 5:139487070-139487092 ATTTTTCCATGGATGGGAAGGGG + Intergenic
998416596 5:141950668-141950690 CTTTTTACAAGGATGGTGAGAGG - Intronic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
999156082 5:149458501-149458523 CTTATTCCTTAGATGGGGTGTGG - Intergenic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999702360 5:154239569-154239591 ATTTTTCCACGGATGGGGACCGG - Intronic
999761823 5:154707619-154707641 ATTTTTCCACAGCTGGGGTGGGG + Intergenic
1000656370 5:163884137-163884159 ATTTTTCCATGGATGGGGTGAGG + Intergenic
1001026444 5:168228150-168228172 CTGTTACCACAGAGTGGGAGGGG + Intronic
1001026451 5:168228208-168228230 CTGTTACCACAGAGTGGGAGGGG + Intronic
1001542167 5:172547256-172547278 CCGTTTCCTGAGATGGGGAGGGG + Intergenic
1001756029 5:174170767-174170789 ATTTTTCCATAGATAGGGTGGGG + Intronic
1001842991 5:174895356-174895378 TTTTTTTCACAGATGGGAAGGGG + Intergenic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1002534910 5:179870670-179870692 CCTTGTTAACAGATGGGGAGGGG + Intronic
1003490681 6:6618913-6618935 CTTTTTCCACAAAGGTGGGGAGG + Intronic
1003908796 6:10725258-10725280 CTTTATCTACAGATAGGCAGGGG + Intronic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004911782 6:20292744-20292766 ATTTTTCCCCAGATGGGACGGGG + Intergenic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1006443043 6:34063827-34063849 CTGTCTCCCCAGATGGGGGGAGG - Intronic
1006680003 6:35790102-35790124 ATTTTTGTAGAGATGGGGAGGGG + Intronic
1006725997 6:36199345-36199367 ATTTTTCCACAGATGAGGGTGGG - Intronic
1007382946 6:41502522-41502544 CTTTTTCCAGCAAGGGGGAGAGG + Intergenic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1009303124 6:62052588-62052610 ATTTTTCCACTGGTGGGGTGGGG + Intronic
1009526101 6:64748344-64748366 ATTTTTCCACAGACAGGGTGAGG + Intronic
1009932770 6:70195603-70195625 CTTTTGCTAGGGATGGGGAGAGG + Intronic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1013333649 6:109133219-109133241 GTTTTTCCACAGATGCGGCAGGG + Intronic
1014102794 6:117530285-117530307 GTTTTTCCACAGACGGGGTGGGG + Intronic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015508508 6:134014116-134014138 ATTTTTCCACAGACGGGGGCAGG + Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015819579 6:137246025-137246047 GTTTTTCCACAGATGAGGGCAGG + Intergenic
1016663007 6:146602884-146602906 ATTTTTCCATGGATGGAGAGGGG - Intronic
1016845023 6:148561249-148561271 ATTTTTCCGTAGATGGGGTGGGG - Intergenic
1016952984 6:149599222-149599244 CTTTTTCAACAAATGGAGAGAGG + Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017356201 6:153512343-153512365 CTTTTTGCACAAAGTGGGAGAGG + Intergenic
1017804360 6:157930721-157930743 ATTTTTCCACAGATAGACAGTGG - Intronic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1020941361 7:14542600-14542622 CTTTTGCCTCTGCTGGGGAGTGG - Intronic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1021560282 7:21962522-21962544 ATTTTTCCACGGATGGGTTGAGG + Intergenic
1023082553 7:36538994-36539016 CTCTTTTCCCAGGTGGGGAGAGG + Intronic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1023282727 7:38588129-38588151 CTTTTTCTAGAGATGGGGTTTGG + Intronic
1023392319 7:39722089-39722111 CTCTTTCTACATATGGAGAGGGG + Intergenic
1024204332 7:47143232-47143254 ATTTTGCCACAGAATGGGAGTGG + Intergenic
1024650838 7:51402125-51402147 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025054959 7:55757705-55757727 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025104907 7:56162808-56162830 ATTTTTCCACGGATGGGGGTTGG - Intergenic
1025133030 7:56387927-56387949 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025245767 7:57315787-57315809 CTTTTGCCACATATGGGCAGAGG - Intergenic
1025978794 7:66391017-66391039 TTTTTTCCACAGACTGGGGGTGG + Intronic
1026314053 7:69212477-69212499 ATTTTTCCACAGATAAGGGGTGG - Intergenic
1026575768 7:71570475-71570497 CTTTTTCCTGGGGTGGGGAGTGG + Intronic
1026927328 7:74203648-74203670 TTTTTTGCAGAGATAGGGAGGGG - Intronic
1028057198 7:86261173-86261195 ATTTTTCCACGGACGGGGAAGGG + Intergenic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1028815568 7:95140143-95140165 ATTTTTCCACTGTAGGGGAGTGG + Intronic
1029613961 7:101644782-101644804 CTTTCTCCACAGGGGAGGAGAGG + Intergenic
1029901863 7:104049457-104049479 GTTTTGTCAGAGATGGGGAGTGG + Intergenic
1029979071 7:104861474-104861496 CTATTTCCACAGCTATGGAGAGG + Intronic
1030124580 7:106141716-106141738 TCTTTTACACACATGGGGAGAGG - Intergenic
1030948805 7:115763330-115763352 ATTTTTCCACGGAAGGGGAGTGG + Intergenic
1031169685 7:118277039-118277061 ATTTTTCCACAGAGGAGGTGGGG - Intergenic
1031221820 7:118976319-118976341 ATTTTTCCACGGACGGGGAGGGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031360380 7:120842659-120842681 CTTTTTAGAAAGATGGGCAGTGG + Intronic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1033167885 7:139057176-139057198 ATGTTTCTAGAGATGGGGAGGGG - Intronic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1034708556 7:153170546-153170568 CTTTGTGTAGAGATGGGGAGGGG + Intergenic
1034953301 7:155316112-155316134 CCGTTGCCACAGATGGGGAGAGG + Intergenic
1035042151 7:155936713-155936735 GTGAGTCCACAGATGGGGAGTGG + Intergenic
1035774094 8:2173959-2173981 ATTTTTCCACGGACGGGGTGAGG + Intergenic
1036132707 8:6131276-6131298 ATTTTTCCACGGATGAGGACGGG + Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036585547 8:10120044-10120066 CTCTTTCCACAGTTTGGCAGTGG - Intronic
1037093115 8:14947059-14947081 CTTTTTTTTCAGATGGGGAGAGG - Intronic
1037472672 8:19225755-19225777 CATTTTCCTGAGATGGGGAAAGG - Intergenic
1037589903 8:20303812-20303834 CTTTTTCCAGAGCTGCTGAGCGG + Exonic
1037603585 8:20419311-20419333 GTTTTTCCATGGATGGGGGGTGG + Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038195055 8:25359727-25359749 ATTTTTCCACGGATGGGGGCAGG - Intronic
1038514898 8:28179494-28179516 ATTTTTCCACAGATAGTAAGGGG + Intronic
1038607659 8:29024969-29024991 ATTTTTCCACCGACGGGGTGGGG - Intronic
1039187328 8:34931822-34931844 ATTTTTCTACAGAAGGGGCGGGG + Intergenic
1039594453 8:38778749-38778771 ACTTTTTCCCAGATGGGGAGAGG + Intronic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1042225935 8:66514344-66514366 GTTTTTGAACAGATGGGGACAGG - Intronic
1042259886 8:66847619-66847641 CTTTTTAAAAAGAAGGGGAGGGG - Intronic
1043445228 8:80313046-80313068 ATGTTTCCACAAATGGGGTGGGG + Intergenic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044519042 8:93176551-93176573 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1044556313 8:93565955-93565977 CTGTTTCCTCAGCTGGGAAGTGG + Intergenic
1044784951 8:95783700-95783722 GTTTTTCCATGGATGGGGTGTGG - Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045327458 8:101127395-101127417 CTATTTCCACACAAGAGGAGAGG - Intergenic
1045872905 8:106946410-106946432 CTTTTTCCACAGATTGGTCCAGG + Intergenic
1045877531 8:106999736-106999758 ATTTTTCCACAGACAGGGTGGGG - Intergenic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1046063324 8:109165646-109165668 CTTAGTCCAGGGATGGGGAGTGG - Intergenic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1048159735 8:132004509-132004531 GTTTTTCCAAGGATGGGGACTGG - Intronic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1048660478 8:136594762-136594784 CTTTTTCCACAGTTATGAAGTGG - Intergenic
1049526666 8:143130258-143130280 CTTTTCCCAGAGATGGGAATCGG + Intergenic
1049857863 8:144874982-144875004 CTTTCTCCAGAGAAGGTGAGAGG + Intergenic
1050034969 9:1425243-1425265 CTTTTTCCAAAGCAGGGGATGGG - Intergenic
1050127632 9:2375836-2375858 AGTTTTCCACAGATGGTGGGTGG + Intergenic
1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG + Intronic
1050844948 9:10204009-10204031 CTTTTTTCACTATTGGGGAGTGG - Intronic
1051212430 9:14758658-14758680 CTTTTTCATCAGATGGTGGGGGG + Intronic
1051332124 9:16033691-16033713 GTTTTTCCACAGACAGGGGGTGG - Intronic
1051372803 9:16372672-16372694 CCTTTTCCTCAGATGGGGAAAGG + Intergenic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052214691 9:25951611-25951633 TTTTTTCCAGAGTTGAGGAGAGG - Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055354957 9:75428295-75428317 ATTTTTCCACAGACTGGGAGGGG - Intergenic
1055369568 9:75582600-75582622 CTTTTTCCACTCATGGCAAGGGG - Intergenic
1055409979 9:76018577-76018599 ATTTTTCCACGGATGTGGGGTGG - Intronic
1055786520 9:79874835-79874857 CTTTTTCCTCAAATGGCAAGTGG + Intergenic
1056515375 9:87344550-87344572 CATTTTCCCCAGATGGAGAGTGG - Intergenic
1057167165 9:92938053-92938075 GTTTTTCCATGGATGGGGAGGGG - Intergenic
1057447456 9:95127398-95127420 ATGTTTCCACAGACCGGGAGGGG + Intronic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1057984771 9:99702001-99702023 GTTTTTCCATGGATGGGGCGGGG + Intergenic
1057986630 9:99723069-99723091 CTCTGTGCACAGATGTGGAGGGG + Intergenic
1058038915 9:100283137-100283159 TTTTTTGTAGAGATGGGGAGGGG - Intronic
1058538862 9:105991408-105991430 CTATTTCCACCCATGGAGAGGGG - Intergenic
1058824988 9:108767312-108767334 TTTTTTCCACTGATGGGCAGGGG - Intergenic
1060333950 9:122704153-122704175 TTTTTTCCACGGATGGTGGGAGG - Intergenic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1060874382 9:127070067-127070089 GTTTTTCCACGGATGGAGAGTGG + Intronic
1061229004 9:129301365-129301387 CTTTGTCGACAGAGGTGGAGTGG + Intergenic
1061365057 9:130168360-130168382 CTATTTGCTAAGATGGGGAGTGG - Intergenic
1061527860 9:131182548-131182570 TTTTTTCCACAGACGGACAGCGG - Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1062597562 9:137306091-137306113 GTCATTTCACAGATGGGGAGGGG - Intergenic
1185728139 X:2439480-2439502 ATTTTTCCACTGATGTGGGGTGG + Intronic
1185800453 X:3005880-3005902 GTTTTTCCACAGACAGGAAGGGG + Intergenic
1186489219 X:9958483-9958505 CTTCTGCCACAGAAGGGGACTGG + Intergenic
1186996709 X:15131400-15131422 TTTTTTCCACAGACGGGGGGTGG - Intergenic
1187013874 X:15307368-15307390 ATTTTTCCACAGATGAGGGTGGG + Intronic
1187396459 X:18923552-18923574 CTCATTCCACAGAAGGTGAGGGG + Intronic
1187909121 X:24094082-24094104 ATTTTTTCACAGATAGGGGGTGG - Intergenic
1188283932 X:28305112-28305134 GTTTTTCCACAGATGTGGGAAGG + Intergenic
1188533782 X:31171959-31171981 TTTTCTCCACTCATGGGGAGTGG - Intronic
1189596449 X:42571323-42571345 CTTTTTCGAGAGATGGGTTGAGG - Intergenic
1189609707 X:42719094-42719116 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1190131171 X:47750186-47750208 CTTCTTTCTCAGATGGGCAGTGG + Intergenic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1191901078 X:66041125-66041147 GTTTGTGCAGAGATGGGGAGTGG + Intergenic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1193308352 X:79975819-79975841 CTTCATGCACAGATTGGGAGGGG - Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1194649058 X:96493159-96493181 ATTTTTCCATTGATGGGGTGAGG - Intergenic
1195124306 X:101790289-101790311 ATTTTTCCACCGATGGGGTGTGG - Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1195900037 X:109788121-109788143 CTTTTTCCATGGTGGGGGAGAGG - Intergenic
1196226019 X:113167639-113167661 CTTTTTTCAGATATGGAGAGTGG - Intergenic
1196824107 X:119727512-119727534 CTTGTTCCACTGCTGGGCAGGGG + Intergenic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197604150 X:128564721-128564743 CTTTATCCTAAAATGGGGAGTGG - Intergenic
1197715083 X:129700818-129700840 CTTGTACCACAGATGAGCAGAGG + Intergenic
1197808840 X:130423155-130423177 ATTTTTCCACAAATGGGGGTGGG - Intergenic
1198323745 X:135545881-135545903 CTTTTTCATCAAATTGGGAGGGG - Intronic
1198775879 X:140178555-140178577 CTGTTTTCAAAGATGGGGCGGGG - Intergenic
1200254182 X:154570664-154570686 AGTTTTCCACAGACGGGGATGGG + Intergenic
1200263587 X:154633744-154633766 AGTTTTCCACAGACGGGGATGGG - Intergenic
1201326472 Y:12765687-12765709 ATTTTTCCACAGACTGGGTGGGG - Intronic
1202093396 Y:21217566-21217588 ATTTTTACAGAGAAGGGGAGAGG + Intergenic
1202193157 Y:22265806-22265828 ATTTTTCCACAGATCATGAGTGG + Intergenic