ID: 947001168

View in Genome Browser
Species Human (GRCh38)
Location 2:225458197-225458219
Sequence TGTACTCTGCGTACTACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947001168 Original CRISPR TGTACTCTGCGTACTACAGG TGG Intronic
901882998 1:12204916-12204938 TGTAATCTCAGTACTTCAGGAGG + Intronic
903474310 1:23608914-23608936 TGAACTCTGCGTACTACACGAGG + Intronic
905493937 1:38369813-38369835 TGTACTGTACCTACTACAGCGGG + Intergenic
915284980 1:154846802-154846824 TTTACTGTGCTTACTAGAGGAGG + Intronic
916251330 1:162741485-162741507 TGTACTCTGCCAACTACATAGGG + Intronic
919339428 1:196284663-196284685 TATTATCTGGGTACTACAGGAGG - Intronic
1074629024 10:115229021-115229043 TGTAATCTCAGCACTACAGGAGG - Intronic
1080614103 11:33931212-33931234 TGTAATCTGAGTACTTAAGGTGG - Intergenic
1085980943 11:81724337-81724359 TGTAATCTGAGTACTTTAGGAGG + Intergenic
1089573904 11:119427851-119427873 TGTAATCTGAGTACTTTAGGAGG + Intergenic
1092686353 12:11051604-11051626 TGGACGTTGCGTATTACAGGAGG - Intronic
1092990235 12:13890312-13890334 TGTAGTTTGCTTACTAGAGGCGG - Intronic
1095664234 12:44776793-44776815 TATACACTGCTTACTACAGGAGG - Intronic
1101411461 12:104472226-104472248 TGTACTCCCAGTACTTCAGGAGG - Intronic
1103502635 12:121415362-121415384 TGTAATCTGAGCACTTCAGGAGG + Intronic
1103929587 12:124442672-124442694 GGTACACTGCCTAGTACAGGTGG + Intronic
1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG + Intronic
1111497622 13:89072865-89072887 TGGACTCTGCGGACTTGAGGGGG - Intergenic
1117403787 14:55381993-55382015 ACTACTCTGCCTACTACAGCTGG - Exonic
1118746361 14:68776302-68776324 TTTCCTCTGAGTACTACAGAGGG - Intergenic
1127854653 15:62944603-62944625 TGTAATCTCCGCACTTCAGGAGG + Intergenic
1143527791 17:7482509-7482531 TGGACTCTGGACACTACAGGAGG + Exonic
1146730970 17:35193761-35193783 TGGACTCTGGACACTACAGGAGG - Exonic
1154115531 18:11610120-11610142 TGGACTCTGGACACTACAGGAGG + Intergenic
1157197075 18:45628187-45628209 TGTAATCTCAGTACTTCAGGAGG + Intronic
1166569958 19:43788827-43788849 TGTAATCTCAGTACTTCAGGAGG - Intergenic
1167855720 19:52238032-52238054 TGTAATCTGAGCACTTCAGGAGG - Intergenic
925702735 2:6655145-6655167 TGTACTCTGGAAACTTCAGGAGG - Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
928682616 2:33717821-33717843 TGTTCTCTGCACACTGCAGGTGG - Intergenic
930875418 2:56210179-56210201 TGTAATCTATGTACTACATGAGG + Intronic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
937695906 2:124808347-124808369 TGTAATCTCAGTACTTCAGGAGG + Intronic
943487365 2:188502917-188502939 TGAACTCTGTGTGCTCCAGGAGG + Intronic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
1172835730 20:37871917-37871939 TGTTCTCTGCATACTCTAGGGGG - Exonic
1173722219 20:45269322-45269344 TGTTCTCTGCCTCCCACAGGAGG + Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178625421 21:34213397-34213419 TGTAATCTCAGTACTTCAGGAGG - Intergenic
956212597 3:66817003-66817025 TGTAATCTCAGTACTTCAGGAGG - Intergenic
959039525 3:101405156-101405178 TGTACTCTGCTTCCTTCAGGAGG - Intronic
959705360 3:109334288-109334310 TGTAGTCTGAGTGCTATAGGAGG + Intronic
964985578 3:162733575-162733597 TGTACTCCCAGTACTTCAGGAGG + Intergenic
965776613 3:172238409-172238431 TGTAATCTCTGTACTTCAGGAGG - Intronic
971847382 4:31937004-31937026 TGGACTCTGGGGACTCCAGGTGG + Intergenic
981524538 4:145696774-145696796 TGTACTCTCAGTACTTCAGGAGG + Intronic
986534037 5:8767792-8767814 TGTACTCTGAGTTCAAAAGGAGG - Intergenic
988833488 5:35009337-35009359 TGTAATCTTAGTACTTCAGGAGG + Intronic
990630729 5:57666042-57666064 TGTCATTTGCGTACTACGGGTGG - Intergenic
1010354219 6:74911434-74911456 TGTTCTCCGTGTAATACAGGAGG + Intergenic
1010895173 6:81353114-81353136 TTTTCTCTGCTTACTATAGGAGG - Intergenic
1028297046 7:89146767-89146789 TGTAATCTGAGTACTTCGGGAGG + Intronic
1029812705 7:103065477-103065499 TGGACTCTGAGTGATACAGGAGG - Intronic
1030624879 7:111833283-111833305 TGTAATCTGAGTACTTTAGGAGG + Intronic
1036407734 8:8470030-8470052 TGTAATCTCAGCACTACAGGAGG - Intergenic
1036737567 8:11331631-11331653 TGGACTCTGGACACTACAGGAGG + Exonic
1046169178 8:110483172-110483194 TGTACTCTGCATTATAAAGGTGG + Intergenic
1049515085 8:143050092-143050114 TGGACTCTGCGCCCTGCAGGTGG + Intronic
1060610538 9:124960349-124960371 TGTAATCTGAATACTTCAGGAGG - Intronic
1187145241 X:16631090-16631112 TGTAATCTCAGTACTTCAGGAGG + Intronic
1189290371 X:39880896-39880918 TGTCCACTGCCCACTACAGGGGG + Intergenic