ID: 947004955

View in Genome Browser
Species Human (GRCh38)
Location 2:225500378-225500400
Sequence TTGTGAAAAATGAACTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947004955_947004960 21 Left 947004955 2:225500378-225500400 CCTTGGTAGTTCATTTTTCACAA 0: 1
1: 0
2: 3
3: 17
4: 256
Right 947004960 2:225500422-225500444 AGGATTTCTGGATCTGTCTGAGG 0: 1
1: 0
2: 3
3: 36
4: 555
947004955_947004957 1 Left 947004955 2:225500378-225500400 CCTTGGTAGTTCATTTTTCACAA 0: 1
1: 0
2: 3
3: 17
4: 256
Right 947004957 2:225500402-225500424 GATTCCGTAAATACATGGCTAGG 0: 1
1: 0
2: 0
3: 4
4: 55
947004955_947004959 9 Left 947004955 2:225500378-225500400 CCTTGGTAGTTCATTTTTCACAA 0: 1
1: 0
2: 3
3: 17
4: 256
Right 947004959 2:225500410-225500432 AAATACATGGCTAGGATTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 206
947004955_947004956 -4 Left 947004955 2:225500378-225500400 CCTTGGTAGTTCATTTTTCACAA 0: 1
1: 0
2: 3
3: 17
4: 256
Right 947004956 2:225500397-225500419 ACAATGATTCCGTAAATACATGG 0: 1
1: 0
2: 1
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947004955 Original CRISPR TTGTGAAAAATGAACTACCA AGG (reversed) Intronic
900828482 1:4946027-4946049 TTGTTCAAAATTAACTTCCATGG - Intergenic
903255626 1:22097038-22097060 TTGTGACATATGAACTAAAAAGG - Intergenic
903569868 1:24296379-24296401 TTGTGAAAAAAAATCTACTATGG + Intergenic
905123231 1:35698640-35698662 TTGTGAATAATGCAGTAACATGG + Intergenic
905698472 1:39993679-39993701 TTGTGACATATGAAATAGCAAGG + Intergenic
906701694 1:47864342-47864364 TTGTAACAAATGAACCACCCTGG + Intronic
909430253 1:75580308-75580330 TTCTGAAAAATGAATTACCACGG + Intronic
910072113 1:83229589-83229611 TTTTGAAAGAAGATCTACCATGG + Intergenic
911325671 1:96468736-96468758 TTGTAAAATCTGAACTAGCAGGG + Intergenic
912197886 1:107421549-107421571 TTGTGACAAATGAAACACCTTGG + Intronic
912252928 1:108029919-108029941 TTGTGAAGAATGAACTCAAATGG + Intergenic
913695017 1:121316368-121316390 TTCTCTAGAATGAACTACCAGGG + Intronic
914142544 1:144963690-144963712 TTCTCTAGAATGAACTACCAGGG - Intronic
916375019 1:164143831-164143853 ATTTCAAAAATGAACTTCCACGG - Intergenic
917994858 1:180425831-180425853 TGGTGAAATATGAACTAACTTGG - Intronic
918819950 1:189240297-189240319 TTGTATAAAATGAATTATCAAGG + Intergenic
918908656 1:190534100-190534122 ATGTGAACAATGAACAAACAGGG + Intergenic
918960449 1:191269535-191269557 TTGTGACAAATAAACTACAGCGG + Intergenic
919587828 1:199461252-199461274 GTTTGAACAAGGAACTACCAGGG + Intergenic
920482350 1:206334754-206334776 TTCTCTAGAATGAACTACCAGGG + Intronic
921213441 1:212918656-212918678 TGGTGAAAAATGAAATTCCAGGG - Intergenic
921636776 1:217504875-217504897 TAGTGAAAAATGAGCAAACAAGG + Intronic
922019922 1:221693365-221693387 TTGTGCAAAGTGAACTATCGTGG + Intergenic
923728914 1:236532005-236532027 TTGTGAAATGTGGACTGCCAGGG + Intronic
924200263 1:241651220-241651242 TTTTAAAAGATGGACTACCAAGG + Intronic
1064857593 10:19787545-19787567 TTGTGAAAATTAAACTTCTATGG - Intronic
1065062729 10:21923280-21923302 TTCTAAAAAATGAACTATAATGG - Intronic
1066225110 10:33374713-33374735 TTCTGAAAAATAAACTAACTGGG - Intergenic
1067286818 10:44912963-44912985 TTGTGAAAGTTGAAGGACCAGGG - Intronic
1068167051 10:53343869-53343891 TTGTTAAAAATGATGAACCAGGG + Intergenic
1070245922 10:74731049-74731071 GTGTGAAGAATGCACTCCCAAGG - Intergenic
1071306862 10:84307174-84307196 TTGAGAGTAATCAACTACCAAGG + Intergenic
1073629499 10:105134400-105134422 CTGTGAAAAATAAATTTCCATGG - Intronic
1074472372 10:113739012-113739034 TTTTCAAAAATGTAGTACCAAGG + Intergenic
1075109539 10:119567026-119567048 TTGTGAAAAATGTGTAACCATGG + Intergenic
1075933571 10:126320852-126320874 TTGTGAAAAATGGGGAACCAAGG + Intronic
1076304665 10:129456537-129456559 CTGTGGAAAATGAAGCACCAAGG - Intergenic
1078050139 11:7957923-7957945 TTATGAAAAATGAAAAACTATGG - Intergenic
1078601320 11:12733556-12733578 TTGTGAAAAGTGAGCTTGCAGGG + Intronic
1079739761 11:24043258-24043280 TTGTAAAAAATCAATTACCTGGG - Intergenic
1080450297 11:32373765-32373787 TTGTGAATAATTAAATTCCAAGG - Intergenic
1081318993 11:41667578-41667600 TTGAGGAAAATGAGCTTCCAGGG + Intergenic
1083078184 11:60063399-60063421 TTTTTAAAAATGAACCATCAGGG - Intronic
1083533452 11:63446805-63446827 CTGTGGAATAAGAACTACCAAGG + Intergenic
1084781236 11:71410024-71410046 CTATGAAAAATGAAATACCTAGG - Intergenic
1085947631 11:81290985-81291007 TTGTGAGAAATGAACTGTGATGG - Intergenic
1086234695 11:84614932-84614954 TCATGAAAAATGAAGAACCATGG - Intronic
1086398430 11:86441083-86441105 TTCAGAAAAGTGAACTCCCAGGG + Intergenic
1086538005 11:87872408-87872430 TTGTAACAAATGTACTACCCAGG - Intergenic
1086662736 11:89441402-89441424 TTGTGAAATATTAAGCACCACGG - Intronic
1088528517 11:110783413-110783435 TTGTAAAGAAAGAAATACCAAGG - Intergenic
1088556965 11:111071590-111071612 TTGTGAAAAATGAAGCAAGAGGG - Intergenic
1090194597 11:124803780-124803802 TTTTAAAAAATCAACTACCTAGG - Intergenic
1092029439 12:5271969-5271991 TTGGGAAAAATGGATCACCAGGG - Intergenic
1092454370 12:8629493-8629515 TTGTTAAAAATGAACTAGCCAGG - Intergenic
1093428745 12:19059105-19059127 TTGAGAAAAATGAAATAAGATGG + Intergenic
1095052072 12:37563312-37563334 TTGAGAGAAATTAAATACCAGGG - Intergenic
1096342487 12:50813509-50813531 TTCTTAAAAATTAACTATCATGG + Intronic
1097601174 12:61694860-61694882 TTGTGAAAAAAGAACTTCCCCGG - Intergenic
1098016753 12:66113159-66113181 TTGTGAAAAAAGCTCTACAATGG + Intergenic
1098404061 12:70105289-70105311 TTGTAAAAAATAAAGAACCAAGG - Intergenic
1098954235 12:76671830-76671852 TTCTGAAAAAAGAACAACTAGGG - Intergenic
1099961930 12:89405156-89405178 TTGTAAAAAATGAACTAACATGG + Intergenic
1099961931 12:89405179-89405201 TTAAAAAAAATGAACTAACATGG + Intergenic
1101695823 12:107125335-107125357 TTATGAAAAATGACTAACCATGG - Intergenic
1101749208 12:107569420-107569442 TTGTGAAAATTTATCAACCATGG - Intronic
1102708276 12:114902051-114902073 TTGGGAAAAATGAAGCACAAAGG - Intergenic
1103126761 12:118430003-118430025 TGGTGAAATATGACCTTCCAGGG - Intergenic
1104153916 12:126111856-126111878 GAGTGAAAAATGAACTTCTATGG - Intergenic
1104269695 12:127272070-127272092 TTGTGAAAAATGAACAGCAAAGG + Intergenic
1104621798 12:130319364-130319386 CTGTGACAAATGAAACACCAAGG + Intergenic
1107050106 13:36037898-36037920 CTGTAAAAAAAGAACTTCCAAGG + Intronic
1107188563 13:37551660-37551682 TTTTGAAAAATGGAATAACAGGG + Intergenic
1107861119 13:44661625-44661647 TTGAGAAAAGTGAACTATCAAGG - Intergenic
1109674389 13:65655055-65655077 TTGAGAAAAGTGAAGTATCAAGG - Intergenic
1109811156 13:67514403-67514425 TTGAAGAAAATGAATTACCAAGG - Intergenic
1110668597 13:78148264-78148286 TTGTGAAAAAAAAAAAACCATGG - Intergenic
1111217344 13:85161565-85161587 GTTTTAAAAATGAAGTACCATGG + Intergenic
1112137526 13:96598200-96598222 CTGTGAAAAATGATCTATCTGGG + Intronic
1112624743 13:101091285-101091307 TTTTGAGAAATGAGCTAGCAGGG - Intronic
1112686401 13:101832892-101832914 ATGTTTAAAAAGAACTACCAGGG + Intronic
1113279298 13:108771449-108771471 TTGTAACAAATGAACTACTCTGG - Intronic
1115861561 14:37692120-37692142 TTCTGAAAAATAAACTAGAAGGG + Intronic
1116747686 14:48842723-48842745 TTGTACAAAATGGACTACCCTGG - Intergenic
1120329058 14:83065143-83065165 TTGGCATAAAAGAACTACCATGG + Intergenic
1121977424 14:98418409-98418431 ATGTGTATAATAAACTACCAAGG - Intergenic
1122039995 14:98980393-98980415 TTGTGAAAAATAAATTCCTATGG + Intergenic
1123958361 15:25365172-25365194 TTTTAAAAAATGAACTCCCTAGG - Intronic
1125103452 15:35942891-35942913 TTGAGCAAAATGGACTGCCATGG + Intergenic
1125350069 15:38757149-38757171 GTAGGAAAAATGGACTACCATGG + Intergenic
1126987991 15:54336908-54336930 TTGTGAAAAATGAAGAAACGAGG - Intronic
1132401767 15:101513503-101513525 TTGTGACAAATGTACCACCATGG - Intronic
1138538142 16:57670882-57670904 TTTTAAAAAATCAAATACCAGGG + Intronic
1139098004 16:63728861-63728883 TTGATAAAAATGAAATAACAAGG - Intergenic
1141466501 16:84209328-84209350 TTGTGACAAATGTACCACCATGG - Intergenic
1143341044 17:6211148-6211170 ATCTGAATAATGAACTACCATGG + Intergenic
1148729100 17:49820099-49820121 TTTTGAAAAATTAACTAACCAGG + Intronic
1153017686 18:598222-598244 TAGAGAATGATGAACTACCATGG + Intronic
1155612483 18:27682624-27682646 TTGTGAAAGATGATTTTCCATGG + Intergenic
1155856004 18:30835436-30835458 TTGTGAAAAATGTACCACTGTGG + Intergenic
1156434094 18:37107594-37107616 CAGTGAAAAATGAAATACCTAGG - Intronic
1156966047 18:43093878-43093900 TTATGCAAGATGAGCTACCAAGG + Intronic
1157007100 18:43595944-43595966 TTTTGAAAAATGCAGTACTAGGG + Intergenic
1158385739 18:56989307-56989329 TTGAGAAAAATTAACTTTCAAGG - Intronic
1159090070 18:63838059-63838081 TTCTCTAAAATTAACTACCAGGG - Intergenic
1159123624 18:64198045-64198067 TTGTGAAAAATGAACAATTTTGG + Intergenic
1159426898 18:68300766-68300788 TTATGAAAAAAGAAATTCCAGGG + Intergenic
1159521428 18:69529822-69529844 TTGTGAAATATGAAATACAGGGG - Intronic
1161572703 19:5039146-5039168 TTTTGAAAAATGCCTTACCAGGG + Intronic
1162873077 19:13600389-13600411 TTCTGCAAAATGAGCCACCATGG + Intronic
1163728245 19:18934546-18934568 CTTTGAAAAATGATGTACCATGG + Intronic
1164663539 19:30003036-30003058 TAGTGAAAAATGTAATAGCATGG + Intronic
1165571870 19:36782271-36782293 TTGAGAGAAATTAAATACCAAGG + Intergenic
1165682119 19:37786614-37786636 TAAAAAAAAATGAACTACCAAGG + Intronic
1167136709 19:47620730-47620752 TTGTGAAAAATGACCATCCCTGG + Intronic
1167193563 19:48009520-48009542 TTGTGAAGAATGACTCACCAAGG - Intronic
925293729 2:2764568-2764590 TTGAGAAAAATGAATTCCAAAGG - Intergenic
927352558 2:22134620-22134642 TTCTGAGGAATGAACTATCAGGG + Intergenic
927785231 2:25969530-25969552 TTGTGAAAAATAAAATAAAAAGG + Intronic
928777550 2:34783852-34783874 TTTTAAAAAATAAACTATCAAGG - Intergenic
928777662 2:34785783-34785805 TTTTTAAAAATAAACTATCAAGG - Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
935767337 2:106381868-106381890 TTGTGAGAGATGAAGTACAAGGG + Intergenic
937779548 2:125821567-125821589 TTGTTAAAGATGACCTAACAGGG - Intergenic
938371484 2:130771363-130771385 CTCTGAAAAATGAAGTCCCAGGG + Intergenic
939145724 2:138412452-138412474 TTGGGCAAATTGACCTACCATGG - Intergenic
939390676 2:141565586-141565608 TTGGGATAAATGAACTACATAGG - Intronic
940229730 2:151437801-151437823 ATTTGTAAAATGAACTAACATGG - Intronic
940266493 2:151844339-151844361 GTGTGAAAACTGAACTTACAAGG + Intronic
941226759 2:162859407-162859429 TAGTGACAAATGATCTGCCAGGG - Intergenic
941322617 2:164074018-164074040 TTTTCAGAAATGAAGTACCAGGG - Intergenic
941619842 2:167764878-167764900 TTGTAAAGCAAGAACTACCAAGG - Intergenic
942305906 2:174607465-174607487 TTCTGACAAATGAACTTCAAGGG + Intronic
942428182 2:175881240-175881262 TTGTGAAAAATAAACTGTAAGGG + Intergenic
943132641 2:183873670-183873692 TTTTAAAAAATTAACTACAAAGG - Intergenic
943168186 2:184359984-184360006 CTGTGAAAAATGATCTATTAGGG + Intergenic
944193901 2:197032223-197032245 GTGTGGAAAATGAACTACAATGG + Intronic
944341635 2:198608109-198608131 GTGAGAAAAATGAGCTACAAAGG + Intergenic
944576108 2:201092477-201092499 TTTTTAAAAATAAACTACCTGGG - Intergenic
945171098 2:206995908-206995930 TTGAGTAAAATGAACTGGCATGG + Intergenic
945595624 2:211787093-211787115 TTGTGAAAAATCAAACTCCAAGG - Intronic
946437991 2:219671724-219671746 TTGTGGAGAAAGAACTGCCATGG + Intergenic
947004955 2:225500378-225500400 TTGTGAAAAATGAACTACCAAGG - Intronic
947343401 2:229164355-229164377 TTATGAAAATTGAACTAAGAGGG + Intronic
1171546610 20:26006821-26006843 TTGAGAGAAATTAAATACCAAGG - Intergenic
1173748854 20:45460043-45460065 TTTTAAAAATTAAACTACCATGG + Intergenic
1175766426 20:61595804-61595826 GTGGGAAAGATGAACTATCAGGG + Intronic
1176524316 21:7853975-7853997 TGGTGAAATAGGAACTAACAGGG + Intergenic
1177167814 21:17622748-17622770 TTGTAAATATTGAACTATCATGG + Intergenic
1177453848 21:21308640-21308662 TTGTTAAAAATGATCAATCAAGG - Intronic
1178658336 21:34483988-34484010 TGGTGAAATAGGAACTAACAGGG + Intergenic
1180311649 22:11245600-11245622 TGGTGAAAAAGGAAGTATCATGG - Intergenic
1183214762 22:36472471-36472493 TTGTGACAAATGGACCACCCTGG + Intronic
949210242 3:1490551-1490573 TTGTGTATAATTAATTACCAGGG + Intergenic
949266120 3:2158207-2158229 TTGTGACAAATGACTTACAAAGG + Intronic
950046495 3:9951524-9951546 GTTTGAGAAATGAACTAACAAGG - Intronic
952183516 3:30943934-30943956 TAGTGTAAAATGATCTACCTTGG - Intergenic
952671065 3:35969310-35969332 ATGAGAAAATTGAAATACCAAGG + Intergenic
953262009 3:41348808-41348830 TAGTAAAAAATGAACAAACACGG + Intronic
953815959 3:46156713-46156735 TTGTCAAAAATGTACTACTCTGG - Intergenic
954852543 3:53615871-53615893 GTGTCAAAAAAGAACTGCCAAGG - Intronic
956296018 3:67714470-67714492 ATGTGAAATATGAAATGCCATGG + Intergenic
956591222 3:70917135-70917157 GTCTGAAAAATGAAGTACCTAGG + Intergenic
957219742 3:77366526-77366548 TTGTGAAAAATAAATTTCTAGGG + Intronic
957226546 3:77455977-77455999 TTATTAAAAATGAATTATCAAGG + Intronic
957261937 3:77913047-77913069 TTGTGAAATATGTATTACAAAGG + Intergenic
957971155 3:87384336-87384358 TTGTCAGAAATGTACTACCTGGG - Intergenic
958180356 3:90051986-90052008 GTGTGAAAAATTAAATGCCATGG + Intergenic
959360221 3:105380320-105380342 TTGTCAAAAATCCACTAACATGG + Intronic
965460837 3:168960908-168960930 TTGTATCAAATGAACTACTAAGG - Intergenic
966046689 3:175559972-175559994 TTCTGAAAAATGAAGTAGGAAGG - Intronic
966476473 3:180354013-180354035 TTCTGGAAAATGAATTATCATGG - Intergenic
969104883 4:4798604-4798626 TATTCAAAAATGAACTACAAAGG + Intergenic
970119386 4:12735606-12735628 TTGTAAAAAATGTACCACCCTGG - Intergenic
970825646 4:20270087-20270109 TTGTTAAAAATGCAATTCCAAGG - Intronic
970955217 4:21803032-21803054 GTGTCAAAAATGAAGTACTAGGG - Intronic
970994746 4:22252425-22252447 ATATGAAAAATGAAATGCCATGG + Intergenic
971295573 4:25386755-25386777 TTGTGAAAAATGCAGTATCTGGG + Intronic
971904695 4:32711270-32711292 TTCTGGAAAATGCAATACCATGG - Intergenic
972174482 4:36386705-36386727 TTGTGTAAAATGAAATCCCATGG + Intergenic
976012315 4:80505309-80505331 TTCTGAAAAAGGAACTAACTTGG + Intronic
976937390 4:90653677-90653699 TTGTGAAAAATGAAGCATCAAGG - Intronic
976996021 4:91435125-91435147 TTGTTATACATGAAATACCATGG - Intronic
977094694 4:92725363-92725385 TTGTGAAAACTGAAATAATAAGG - Intronic
977719929 4:100228114-100228136 CTGTTAAAAATGAACCAACAAGG + Intergenic
978433104 4:108653929-108653951 TTCTCCAAAATGAACTCCCAGGG - Intronic
978439720 4:108720775-108720797 TGGTGCTAAATGAATTACCAGGG - Intergenic
979822063 4:125187732-125187754 ATGTGAAAAATAAATTTCCATGG + Intergenic
980548854 4:134306608-134306630 TGGAGAAAAATGAAGTAACATGG - Intergenic
980923288 4:139109307-139109329 TTGAGAAAAATGCACTACCACGG + Intronic
981799780 4:148642054-148642076 TTGTGAAGTTTGATCTACCAAGG + Intergenic
981807872 4:148738067-148738089 TTGTGAAAAGATAACTATCAAGG - Intergenic
982044888 4:151434487-151434509 ATGTGAAAAATGATATAACAGGG + Intronic
982330913 4:154181276-154181298 TATTGAAATGTGAACTACCAAGG - Intergenic
982336924 4:154250381-154250403 ATGTGTAAAATGAATTACCTAGG - Intronic
983406574 4:167338721-167338743 TTGTGAAATATGAGCTATAAGGG - Intergenic
983689816 4:170454702-170454724 TGGAGAAAATTGAACTACCAAGG + Intergenic
984275424 4:177603892-177603914 TGGTAAAAAATCAAATACCAAGG + Intergenic
986892360 5:12324323-12324345 TTTTGAAAAATGAACTTCGATGG - Intergenic
987295942 5:16551466-16551488 TGATGAAAAATGAACCAACATGG - Intronic
989712131 5:44411774-44411796 TTCTGAAGAAAGAACTCCCAGGG - Intergenic
989766483 5:45090845-45090867 TTGTGTAATAAGAACTGCCAGGG + Intergenic
989844730 5:46127669-46127691 CGGTGAAAAATGAACAACCCAGG - Intergenic
990024731 5:51172731-51172753 TTGTGAAAAGTGAAATAACCAGG + Intergenic
991581822 5:68163594-68163616 TTGAGAAAAATAAAGTTCCAGGG - Intergenic
995050296 5:107695874-107695896 TTGTGAAAAATGAACAGCAGTGG + Intergenic
995744190 5:115386690-115386712 TTCTGAAAAATTAACCTCCATGG - Intergenic
997695100 5:135855274-135855296 TTGTAAAAAATGAAATATCTGGG + Intronic
997918972 5:137959187-137959209 TTTTGAAAAATGACCTTCAAGGG - Intronic
1000360490 5:160442350-160442372 TTGGAAAAAATGTGCTACCAAGG + Intergenic
1000759406 5:165203685-165203707 TTTTTTAAAATGAATTACCAGGG - Intergenic
1003733993 6:8857196-8857218 CTTTGAAAAATTAACTATCAGGG + Intergenic
1004794130 6:19062301-19062323 GTTTGAAAAATGAGTTACCAAGG - Intergenic
1004930122 6:20454909-20454931 TTTTGAAAATTCAACTACCCGGG + Intronic
1004972420 6:20925630-20925652 TTTTAAAAAATGCACTACTAAGG - Intronic
1005307332 6:24526236-24526258 TTCAGAAAGATGAACAACCAAGG + Intronic
1006559835 6:34901400-34901422 TTGTGAAGATTAAAGTACCAAGG - Intronic
1007875531 6:45096735-45096757 TTGTTGAATATCAACTACCAAGG - Intronic
1009361053 6:62815481-62815503 TAGTAAAAAATGATGTACCAGGG - Intergenic
1012237440 6:96835873-96835895 GTGTGAAAAGTATACTACCAAGG - Intronic
1014135281 6:117881863-117881885 TTCTGAAAAATGGACTCACATGG - Intergenic
1014375133 6:120662603-120662625 TTTTTAAAAATAAATTACCATGG + Intergenic
1016238172 6:141893288-141893310 TTCTCAAAAACAAACTACCAGGG + Intergenic
1017576349 6:155809001-155809023 TAGTGAATAATGAGATACCAGGG + Intergenic
1018057435 6:160064436-160064458 TTGTTAAAAATGAACTTCACGGG + Exonic
1018555672 6:165048444-165048466 TCCAGAAAAAGGAACTACCAAGG + Intergenic
1018585946 6:165359488-165359510 TTGAGAATAATAAAGTACCAGGG - Intronic
1022371652 7:29777182-29777204 TTGTGAAGACAGAACTAACAGGG + Intergenic
1023267455 7:38422453-38422475 TTGTGAATAATGAAGTATCCTGG + Exonic
1024835035 7:53507129-53507151 TTGTGAAAAGTGTACTTCTATGG + Intergenic
1026637262 7:72095162-72095184 ATGAGAAAAATGAAGTACCGAGG - Intronic
1027289828 7:76694569-76694591 TTTTGAAAGAAGATCTACCATGG + Intergenic
1027802637 7:82774699-82774721 TTGTAACAAATGAACTACCCTGG - Intronic
1028540283 7:91936099-91936121 TTGTGAAAGATCAAATAACATGG + Intergenic
1029222125 7:98998908-98998930 TTGTGCAGACTGACCTACCATGG - Intronic
1030026946 7:105333640-105333662 CTGTACAAAATGAACTAGCAGGG - Intronic
1031271761 7:119658622-119658644 TTGTGAATAATTAATTAACATGG + Intergenic
1036059605 8:5301291-5301313 TTGTGAAAAATGAAATGTAAAGG + Intergenic
1038424575 8:27456213-27456235 TTGTAAAAAATGAAATATCTGGG - Intronic
1038586862 8:28797512-28797534 TTGTGAACTAGGAACTCCCAGGG + Intronic
1040346260 8:46500125-46500147 TTGTGAAAAATCACATACCTTGG - Intergenic
1040796489 8:51294217-51294239 TTGTGGAGAATGCAATACCAAGG - Intergenic
1040846579 8:51848339-51848361 TTATGAAAAAAGAAAAACCAGGG + Intronic
1043082977 8:75789193-75789215 TTGTGAAAGATATAATACCAAGG + Intergenic
1043142708 8:76609646-76609668 TTGTGAAAAATAAATTAGAAAGG + Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1045086658 8:98693999-98694021 TTGTGAAAAAAGTAGTGCCATGG + Intronic
1045321197 8:101082641-101082663 TGGTGAAAAAGGAACAAGCAGGG + Intergenic
1046079080 8:109348757-109348779 TTGTGAAAAATGTATTTACATGG + Intergenic
1048594669 8:135853707-135853729 TTGTTAAAAATGAAAAATCATGG - Intergenic
1050278361 9:4024105-4024127 TTGGGAAAAATTAACTTTCATGG - Intronic
1051244826 9:15099311-15099333 TTTTGAAAAATTAACTTCCAAGG - Intergenic
1051487121 9:17620941-17620963 TTCTGATAACTAAACTACCAGGG - Intronic
1052023476 9:23550345-23550367 TTCTGATAAATGAATGACCAAGG - Intergenic
1052765249 9:32634114-32634136 ATGGGAAAAATGGAGTACCAAGG + Exonic
1053798198 9:41745327-41745349 TTGAGAGAAATTAAATACCAAGG + Intergenic
1054147001 9:61569621-61569643 TTGAGAGAAATTAAATACCAAGG - Intergenic
1054186612 9:61957377-61957399 TTGAGAGAAATTAAATACCAAGG + Intergenic
1054651893 9:67631144-67631166 TTGAGAGAAATTAAATACCAAGG - Intergenic
1054998997 9:71427041-71427063 TTGTGAATAATGCACTAACCAGG - Intronic
1056804614 9:89718855-89718877 TTGGGAAACATGAAATACGAAGG - Intergenic
1189458336 X:41214688-41214710 TTGTGAAAAATGCAATAAAAAGG + Exonic
1189766361 X:44376432-44376454 TTCTGGAAAATGAAATACCTAGG - Intergenic
1190446961 X:50535464-50535486 TTGTAACAAATCCACTACCACGG + Intergenic
1191566003 X:62531880-62531902 TGGTGAAAAAGGAACTATCTTGG + Intergenic
1191741905 X:64445255-64445277 TTGTGAAAAATGAACTAGGGAGG - Intergenic
1192469144 X:71381772-71381794 ATGGGAAAAATGGAGTACCAAGG - Exonic
1192603292 X:72487259-72487281 TTTTTAAACATGAATTACCATGG + Intronic
1193205782 X:78746139-78746161 TTTTGAAAAAAAAAATACCAAGG - Intergenic
1193512123 X:82415830-82415852 TTGTGAAATTTGAACTGACAAGG + Intergenic
1195005980 X:100686398-100686420 TTGTCCAAAAAGAACTGCCAAGG + Intronic
1195737383 X:108027586-108027608 TTGTAAAACATGAAAAACCATGG + Intergenic
1196476568 X:116093107-116093129 TTATGAAAAATGGAATACAATGG - Intergenic
1197552618 X:127912073-127912095 TTGAGAAAAATGAACCAACATGG + Intergenic
1197832500 X:130659441-130659463 TTGAGAAAAATGAACTTTAAAGG + Intronic
1198366898 X:135950036-135950058 TAATGAAAAATGAACTCTCATGG + Intergenic