ID: 947004971

View in Genome Browser
Species Human (GRCh38)
Location 2:225500754-225500776
Sequence TTGACCTTCTAGCAGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 391}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947004971_947004975 10 Left 947004971 2:225500754-225500776 CCATCTCTCTGCTAGAAGGTCAA 0: 1
1: 0
2: 1
3: 18
4: 391
Right 947004975 2:225500787-225500809 GCAATATACCTGGGAAGTACAGG 0: 1
1: 0
2: 1
3: 8
4: 76
947004971_947004974 1 Left 947004971 2:225500754-225500776 CCATCTCTCTGCTAGAAGGTCAA 0: 1
1: 0
2: 1
3: 18
4: 391
Right 947004974 2:225500778-225500800 GAATAGATGGCAATATACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 103
947004971_947004973 0 Left 947004971 2:225500754-225500776 CCATCTCTCTGCTAGAAGGTCAA 0: 1
1: 0
2: 1
3: 18
4: 391
Right 947004973 2:225500777-225500799 TGAATAGATGGCAATATACCTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947004971 Original CRISPR TTGACCTTCTAGCAGAGAGA TGG (reversed) Intronic
901578178 1:10217862-10217884 TTTACATTCTAGTAGGGAGAGGG - Intronic
903095307 1:20966644-20966666 TTGTACTTTTAGCAGAGACAAGG + Intronic
904516234 1:31057550-31057572 TTGTATTTTTAGCAGAGAGAGGG - Intronic
904742542 1:32689411-32689433 TTGTAGTTCTAGCAGAGACAGGG + Intronic
906006394 1:42476164-42476186 TTTTCCTTCTAGCAAAGGGAGGG + Intronic
906115872 1:43356875-43356897 TTGTACTTCTAGTAGAGACAGGG + Intergenic
906425421 1:45708236-45708258 TTGTACTTTTAGCAGAGACAGGG + Intronic
907286788 1:53385580-53385602 TTGGGCTTCTTGCAGAGAGAAGG + Intergenic
909133812 1:71771526-71771548 TTGTACTTTTAGTAGAGAGAGGG - Intronic
910276043 1:85449924-85449946 TGTCCCTTCCAGCAGAGAGAGGG + Intronic
914352044 1:146848683-146848705 TTGTACTTTTAGCAGAGACAGGG + Intergenic
914522507 1:148430515-148430537 TTGACATTCTAATAGATAGATGG - Intergenic
914727695 1:150341874-150341896 TTGAACTTTTAGTAGAGACAGGG + Intronic
915869850 1:159547094-159547116 TTCACCAACTAGCAGAGATAAGG - Intergenic
916231694 1:162546896-162546918 TTGTCCTTTTAGTAGAGACAGGG - Intergenic
916463614 1:165050341-165050363 TTGACATTAGAGCAGAGAGGTGG + Intergenic
917301620 1:173580523-173580545 TTGAACTTTTAGTAGAGACAGGG + Intronic
917423150 1:174886182-174886204 TTGAAATTTTAGTAGAGAGAGGG + Intronic
918210721 1:182348776-182348798 TTTACATTCTAGCAAGGAGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918958815 1:191244054-191244076 TTGACCTTATATTTGAGAGATGG + Intergenic
920389025 1:205587327-205587349 TTGAATTTCTAGCAGAGAGCGGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922187862 1:223292434-223292456 TTTACCTTCTTGCACACAGATGG + Exonic
922189493 1:223305068-223305090 TTGACCTTGTGGCCAAGAGAAGG - Intronic
924104782 1:240639223-240639245 TTGTACTTCTAACAGAGACAGGG - Intergenic
924318427 1:242822965-242822987 TTGTCCTTTTAGTAGAGAGGGGG + Intergenic
924523890 1:244829393-244829415 TTGTCCTTTTAGTAGAGACAGGG + Intergenic
1063919652 10:10919949-10919971 TTCTCCTTCCTGCAGAGAGACGG + Intergenic
1064041721 10:11971889-11971911 TTGTACTTTTAGCAGAGACAGGG - Intronic
1064056758 10:12104349-12104371 TTGAATTTGTAGCAGAGACAGGG + Intronic
1065608123 10:27442105-27442127 TTGTATTTCTAGCAGAGACAGGG - Intergenic
1066031442 10:31429911-31429933 TTGTATTTCTAGCAGAGACAGGG + Intronic
1066328978 10:34396175-34396197 TTGAATTTTTAGCAGAGACAGGG - Intronic
1066686298 10:37984707-37984729 TTGTCTTTTTAGTAGAGAGAGGG - Intergenic
1068084419 10:52357185-52357207 TTGACCTGCTAGCAGACACTCGG - Intergenic
1068824524 10:61419970-61419992 TTGACCTTCCAGCAAAGTGGGGG + Intronic
1068926261 10:62542475-62542497 TTGGCCTTTTAGCAAAGAGCAGG + Intronic
1070069665 10:73075279-73075301 TTGTCTTTTTAGCAGAGACAAGG + Intronic
1070291400 10:75117540-75117562 TTGTACTTTTAGCAGAGAAAAGG - Intronic
1070526246 10:77298412-77298434 TTGTACTTTTAGCAGAGACAGGG + Intronic
1071803236 10:89088032-89088054 TTGTACTTCTAGTAGAGACATGG + Intergenic
1073310517 10:102536981-102537003 TTGTATTTTTAGCAGAGAGAGGG + Intronic
1074428847 10:113375566-113375588 TTCACATTCTAGCAAAGGGAGGG - Intergenic
1074708254 10:116155345-116155367 TTCCCCCTCTAGCAGAGGGAAGG + Intronic
1075214244 10:120518016-120518038 TTGACCTTCTATCACATTGATGG + Intronic
1076422337 10:130340294-130340316 TTGACCTTCTAGAAATGAAATGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078621401 11:12912151-12912173 ATGACTTTCTAGCAACGAGATGG - Intronic
1079787226 11:24688886-24688908 TAGATCTTCTAGCTGGGAGATGG - Intronic
1080539171 11:33250213-33250235 TTGTATTTTTAGCAGAGAGAGGG + Intergenic
1081801780 11:45864930-45864952 TTGTCCTTTTAGTAGAGACAGGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082883493 11:58060663-58060685 TTGTACTTTTAGCAGAGACAGGG - Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1084540569 11:69783757-69783779 TTGTACTTTTAGTAGAGAGAGGG + Intergenic
1085095158 11:73754744-73754766 TTGACTTTTTAGTAGAGACAGGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087163201 11:94971585-94971607 TTGTCCTTCAAGCAGAAAAAAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087605771 11:100376162-100376184 TTGAAATTATAGAAGAGAGAGGG - Intergenic
1087731599 11:101784387-101784409 TTGAACTTTTAGCAGAGATGGGG + Intronic
1088658110 11:112020739-112020761 TTGCTCCTCTGGCAGAGAGAAGG + Intronic
1089475900 11:118761442-118761464 TTGTACTTTTAGCAGAGACAGGG - Intronic
1089515110 11:119027249-119027271 TTGACCTTGCAGCGGAGAGGGGG - Intronic
1090050074 11:123370140-123370162 TTGAACTTTTAGTAGAGACAGGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090911148 11:131120690-131120712 TTGTACTTTTAGCAGAGACAGGG - Intergenic
1092100660 12:5881207-5881229 TTGACATTCTGCCACAGAGAGGG - Intronic
1092816844 12:12319708-12319730 TTGACCTTCTGCCAAAGTGATGG + Intergenic
1093507691 12:19887786-19887808 TTGAACTTTTCCCAGAGAGAGGG + Intergenic
1095876268 12:47082165-47082187 TTTACCTTCTAGTGGAAAGAGGG - Intronic
1096175052 12:49509439-49509461 TTGTACTTCTAGTAGAGACAGGG + Intronic
1096403445 12:51325660-51325682 TTGTATTTTTAGCAGAGAGAAGG - Intergenic
1096906354 12:54940108-54940130 TTGTATTTCTAGCAGAGACAGGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097793686 12:63841581-63841603 TTCACCATCTAGCAGAGATCTGG + Intergenic
1097960009 12:65523079-65523101 TTGAGCTTGGACCAGAGAGAGGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098460385 12:70726779-70726801 AAGACCTTTTAGCAGAGACATGG - Intronic
1099373430 12:81866191-81866213 TAGAGCTTCTAGGAGGGAGATGG + Intergenic
1099457602 12:82882881-82882903 TTGTACTTCTAGTAGAGACAGGG - Intronic
1100223357 12:92530918-92530940 ATGACCATCTATCAGAAAGAGGG + Intergenic
1100258140 12:92904969-92904991 CTGACCTTCAGGCATAGAGAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101901915 12:108797300-108797322 TTGTACTTCTAGTAGAGACAGGG + Intronic
1102159020 12:110753684-110753706 TTGTCTTTTTAGCAGAGACAGGG - Intergenic
1102864115 12:116360654-116360676 TTGTATTTTTAGCAGAGAGATGG + Intergenic
1102980505 12:117237302-117237324 TTGTACTTTTAGCAGAGACAGGG + Intronic
1103043900 12:117719366-117719388 TTGAACTTTTAGTAGAGACAGGG + Intronic
1103112333 12:118291331-118291353 TTGTCGTTTTAGCAGAGACAGGG + Intronic
1103490943 12:121319404-121319426 TTGTACTTTTAGTAGAGAGAGGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106253853 13:28004096-28004118 GCGACCTTTCAGCAGAGAGATGG - Exonic
1106533941 13:30621799-30621821 TTGCCCTGCTTGTAGAGAGAAGG + Exonic
1106881733 13:34139100-34139122 ATGACCTCCTAGCAGAGACTTGG - Intergenic
1107731932 13:43357426-43357448 TTGAAAATCTAGCAGTGAGAAGG - Intronic
1110234288 13:73200223-73200245 TTGTACTTCTAGTAGAGACAGGG - Intergenic
1113386428 13:109852698-109852720 TTGTCCTTATAGTAGAGACAGGG + Intergenic
1113474401 13:110570018-110570040 TTGTACTTTTAGTAGAGAGAGGG - Intergenic
1113501045 13:110774537-110774559 TTGTACTTTTAGCAGAGACAGGG + Intergenic
1114227314 14:20750927-20750949 TTCTCCTTCTGGCACAGAGAAGG + Intergenic
1115144052 14:30206245-30206267 TTGTCTTTTTAGCAGAGACAGGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1115599628 14:34943023-34943045 TTGTACTTTTAGCAGAGACAGGG - Intergenic
1117846823 14:59920256-59920278 CTGACCTTATCACAGAGAGAGGG - Intronic
1119433135 14:74581344-74581366 TTGACCTTAAAATAGAGAGATGG + Intronic
1119618247 14:76112539-76112561 TTCAGCTCTTAGCAGAGAGAAGG - Intergenic
1119674647 14:76544691-76544713 TTGAGATTCTAGTAGAGAGGGGG - Intergenic
1120657983 14:87218253-87218275 TTGAACTTTTAGTAGAGACAGGG - Intergenic
1120854596 14:89201708-89201730 ATGACCTTATAGCATAGAGAGGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122195488 14:100081949-100081971 TTTAAATTCTAGCAGAGACAGGG - Intronic
1122277433 14:100601799-100601821 TTGCATTTTTAGCAGAGAGAGGG + Intergenic
1122336479 14:100991536-100991558 TCCAGCTTCTAGCACAGAGATGG - Intergenic
1125630507 15:41143289-41143311 TTGTACTTTTAGCAGAGATAGGG - Intergenic
1125752406 15:42037410-42037432 TTCAACTCCTAGCAGAGAGGAGG - Intronic
1127730473 15:61797424-61797446 TTGAACTTTTAGTAGAGAGGGGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129997753 15:80021470-80021492 TTGTGCTTCTAGCAGGGAGAGGG - Intergenic
1130816794 15:87444499-87444521 TTTACCTTTTAGAACAGAGATGG + Intergenic
1130830217 15:87591656-87591678 TTGCCTTTCTAGGAGAGAGGAGG - Intergenic
1130913139 15:88284585-88284607 TTTAGCTTCTTGCAGAGAGAGGG - Intergenic
1131301338 15:91202240-91202262 CTAACCTTCTAGTGGAGAGAGGG - Intronic
1131865241 15:96701653-96701675 TTGTGCTTCTAGCAGCTAGAGGG - Intergenic
1132617399 16:848450-848472 TGGACCTTCTGGCAGGGTGAGGG + Intergenic
1133060784 16:3173250-3173272 TTGTACTTTTAGCAGAGACAGGG + Intergenic
1133837530 16:9380066-9380088 TTGAATTTTTAGTAGAGAGAGGG + Intergenic
1134607924 16:15585655-15585677 TTGTACTTTTAGCAGAGACAAGG - Intronic
1137664481 16:50241635-50241657 TTTACCTTCTTCCAGAGAAAAGG + Intergenic
1139981987 16:70866850-70866872 TTGTACTTTTAGCAGAGACAGGG - Intronic
1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG + Intergenic
1142609236 17:1099245-1099267 TTGCATTTCTAGCAGAGACAAGG + Intronic
1144710680 17:17399584-17399606 TTTTCCTTCTAGCAGTCAGAGGG + Intergenic
1144876994 17:18403162-18403184 TTGTACTTTTAGTAGAGAGACGG + Intergenic
1144940790 17:18938767-18938789 TTGAGCTTCCAGCAGGGAGACGG + Intergenic
1145155236 17:20541246-20541268 TTGTACTTTTAGTAGAGAGACGG - Intergenic
1145228584 17:21152608-21152630 TTGTGCTTCCAGCAGAGGGAGGG + Intronic
1145736716 17:27238229-27238251 TTGACCTCCAAGCAGGGAGCAGG - Intergenic
1147703917 17:42413103-42413125 TTGAAATTTTAGCAGAGATAGGG + Intronic
1148193364 17:45695809-45695831 TCTACCTTCTTGAAGAGAGATGG - Intergenic
1148232671 17:45946427-45946449 TTGAACTTTTAGTAGAGACAAGG - Intronic
1148453729 17:47798980-47799002 TTGTACTTTTAGCAGAGACAGGG + Intergenic
1149677114 17:58475795-58475817 TCCAGCTTCCAGCAGAGAGAAGG + Intronic
1150730732 17:67690928-67690950 TTGTACTTTTAGCAGAGACAGGG - Intronic
1151373423 17:73665481-73665503 TTAACTTTCTTGCAGAGAGTGGG + Intergenic
1152488414 17:80611437-80611459 TTGTACTTCTAGTAGAGAGGGGG + Intronic
1153020340 18:623203-623225 TTGTATTTCTAGCAGAGACAGGG + Intronic
1153261193 18:3226005-3226027 TTGCACTTCGAGAAGAGAGATGG + Intergenic
1153374263 18:4357714-4357736 CTGACCTTGCAGCAGTGAGACGG - Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1154422420 18:14245588-14245610 TTGTACTTTTAGCAGAGACAGGG - Intergenic
1155950908 18:31912316-31912338 TTGTATTTTTAGCAGAGAGAGGG - Intronic
1155966267 18:32038220-32038242 TTGTCTTTTTAGTAGAGAGAGGG + Intronic
1156435283 18:37120435-37120457 TTGACCTTATAGGAAAGAAAGGG + Intronic
1156566266 18:38194846-38194868 TTGTCCTTTTAGTAGAGACAGGG - Intergenic
1157733398 18:50024387-50024409 TGCACCTGGTAGCAGAGAGAAGG - Intronic
1158261998 18:55616836-55616858 TTAACCTTCTATCAGATATATGG + Intronic
1158964328 18:62610192-62610214 TTGTCATTTTAGCAGGGAGATGG + Intergenic
1161136024 19:2620335-2620357 GTGACCTGCCTGCAGAGAGAGGG - Intronic
1161532493 19:4798434-4798456 TTGTGCTTTTAGTAGAGAGACGG - Exonic
1161665985 19:5577283-5577305 TTGTACTTTTAGCAGAGACAGGG + Intergenic
1161866560 19:6836811-6836833 GTGACCATTGAGCAGAGAGATGG + Intronic
1161869212 19:6857385-6857407 AGGACCTGCTAGGAGAGAGATGG + Intergenic
1162114823 19:8422563-8422585 TTGTACTTCTAGCAGAGACGGGG + Intronic
1162176699 19:8835222-8835244 TTGTATTTTTAGCAGAGAGAGGG + Intronic
1162272060 19:9624241-9624263 TTGTACTTCTAGTAGAGACAGGG - Intronic
1162761093 19:12888557-12888579 TTGTATTTTTAGCAGAGAGAGGG - Intergenic
1165765448 19:38347766-38347788 TTGTACTTCTAGTAGAGACAGGG - Intronic
1167014065 19:46828192-46828214 TTGTACTTTTAGCAGAGACAGGG - Intergenic
1167110242 19:47456491-47456513 TTGTACTTTTAGTAGAGAGATGG - Intronic
1167115378 19:47486471-47486493 TTGTATTTCTAGCAGAGACAGGG + Intergenic
1167513778 19:49910837-49910859 TTGACCTTCCTGCTGATAGATGG - Intronic
1167865902 19:52327732-52327754 TTGTACTTTTAGCAGAGACAGGG - Intergenic
1168022365 19:53618852-53618874 TTGTACTTTTAGCAGAGACAGGG + Intergenic
1168024535 19:53634256-53634278 TTGTATTTCTAGCAGAGACAGGG - Intronic
926571300 2:14533245-14533267 TAGGCCTACTAGCAGAGGGAAGG - Intergenic
927612844 2:24559166-24559188 TCGTCCTTTTAGCAGAGAGATGG - Intronic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
930195535 2:48506264-48506286 TTGTACTTCTAGTAGAGACAGGG + Intronic
930378639 2:50598942-50598964 TTGTACTTTTAGCAGAGACAGGG + Intronic
930603748 2:53471112-53471134 AAGACCTTCCAGCAGAGAGGAGG + Intergenic
930645041 2:53897339-53897361 TTGTACTTCTAGTAGAGACAGGG + Intronic
932289013 2:70559553-70559575 TTGAATTTTTAGCAGAGAAAGGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933219230 2:79669575-79669597 TTCAGCTCTTAGCAGAGAGAAGG + Intronic
933386180 2:81613468-81613490 TTGATCTGGGAGCAGAGAGAAGG + Intergenic
933792172 2:85891579-85891601 TTGTACTTTTAGCAGAGACAGGG - Intergenic
934766338 2:96882202-96882224 CTGACCTTCACACAGAGAGAGGG - Intronic
934983937 2:98870511-98870533 TTGGCCTTCTCCCAGGGAGAGGG + Intronic
935434486 2:103014434-103014456 TTAACTTTTTAGTAGAGAGAAGG - Intergenic
938867055 2:135433495-135433517 TTTACCTTCTATCACAGAGTAGG - Intronic
939058432 2:137391513-137391535 TTGTATTTCTAGTAGAGAGAGGG - Intronic
939394851 2:141615357-141615379 GTTACATTCTAGTAGAGAGAAGG - Intronic
939811787 2:146841826-146841848 TTGTATTTCTAGCAGAGACAGGG + Intergenic
940388113 2:153097891-153097913 TTGAATTTCTAGCAGAGAGGGGG - Intergenic
941094128 2:161216279-161216301 TTGGCCGTCTAGCAGACATACGG - Intronic
942025403 2:171905687-171905709 TTGTATTTTTAGCAGAGAGAGGG + Intronic
942236415 2:173911988-173912010 TTGTCTTTCTAGGAGAGACACGG + Intronic
942569402 2:177298134-177298156 TTGTATTTTTAGCAGAGAGAGGG + Intronic
942866403 2:180680807-180680829 CTGACTTTCTACCAGAAAGAAGG - Intergenic
943257294 2:185612119-185612141 TTGTATTTCTAGCAGAGACAAGG + Intergenic
944606331 2:201354818-201354840 CTGGCCTTCAAGAAGAGAGAAGG - Intronic
946951234 2:224877507-224877529 TTGACATTCTAGTAGAGAAGAGG + Intronic
947004971 2:225500754-225500776 TTGACCTTCTAGCAGAGAGATGG - Intronic
947204033 2:227644028-227644050 TTTGCCTTCTAGCAGACAGGTGG + Intergenic
947879183 2:233490342-233490364 TTGTACTTTTAGCAGAGACAGGG + Intronic
948144183 2:235696216-235696238 TTGTACTTCTAGTAGAGACAGGG + Intronic
948877102 2:240835410-240835432 TTGTTCTTCTAGCAGAGGAATGG - Intergenic
949062866 2:241971385-241971407 TTTATCTTCTTGCAGAAAGATGG - Intergenic
1170281351 20:14652586-14652608 TTGACATTTTAGCAAACAGATGG + Intronic
1172341531 20:34161789-34161811 TTGTCTTTTTAGCAGAGACAGGG + Intergenic
1173284886 20:41661315-41661337 TTGTACTTCTAGTAGAGACAGGG - Intergenic
1176161520 20:63651129-63651151 TTGTACTTTTAGCAGAGAGGGGG + Intronic
1176227401 20:64009107-64009129 TTGAAATTTTAGCAGAGACAGGG - Intronic
1176237657 20:64061581-64061603 TTGTATTTCTAGCAGAGACAGGG + Intronic
1176795228 21:13367213-13367235 GTGACTTCCTAGCTGAGAGATGG + Intergenic
1177386426 21:20414901-20414923 TTGACCTTGCAGCACAGAAAAGG - Intergenic
1177934188 21:27321510-27321532 TAGACCTTCTCTCAAAGAGAAGG + Intergenic
1178518909 21:33270845-33270867 TTGTACTTCTAGCAGAGATGGGG + Intronic
1181327733 22:22063619-22063641 TTGTCCTTTTAGTAGAGAGGGGG + Intergenic
1181389545 22:22570244-22570266 TTTTCCTTCTAGCATAGGGAGGG + Intergenic
1183237687 22:36631838-36631860 TGGATCTTCCAGCAGAGACATGG + Intronic
1184492664 22:44819237-44819259 TTGAACTTTTAGTAGAGACAGGG + Intronic
1184619041 22:45660287-45660309 TTAACTTTTTAGCAGAGACAGGG + Intergenic
1185298494 22:50066485-50066507 TTGTACTTTTAGCAGAGACAGGG - Intronic
949275592 3:2276344-2276366 TTGTATTTTTAGCAGAGAGAGGG + Intronic
949824773 3:8154095-8154117 TTGTCCTACTGGCAGAGAGCAGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951537476 3:23752680-23752702 TTGTACTTTTAGCAGAGAGAGGG + Intergenic
951798175 3:26566012-26566034 TTCAGCTCCTAGCAGAGAGGAGG + Intergenic
952702220 3:36339569-36339591 TTGACCTAGTAGCATAGGGATGG - Intergenic
952978157 3:38713798-38713820 TTGTACTTTTAGCAGAGACAGGG + Intronic
953063675 3:39449599-39449621 TTCAGCTACTTGCAGAGAGAAGG - Intergenic
953083172 3:39640710-39640732 TTGAATTTTTAGCAGAGACAGGG + Intergenic
954178283 3:48861552-48861574 TTGTACTTTTAGCAGAGATAGGG - Intronic
954324144 3:49852947-49852969 TTGTACTTGTAGCAGAGACAGGG - Intronic
954607096 3:51920545-51920567 TTGTACTTTTAGCAGAGAAAGGG + Intergenic
955215951 3:56985259-56985281 TTGTATTTTTAGCAGAGAGAGGG + Intronic
955298260 3:57753794-57753816 TTGATCTTCTAGGAGGAAGATGG + Intergenic
955485095 3:59427057-59427079 TTGCCCTTATTGCAGGGAGACGG + Intergenic
957005558 3:74942116-74942138 TTGTCCTTTTAGTAGAGACAGGG + Intergenic
957923119 3:86772453-86772475 TTCAGCTCCTAGCAGAGAGGAGG - Intergenic
958572902 3:95911336-95911358 TTCAGCTCCTAGCAGAGAGGAGG + Intergenic
958874127 3:99596314-99596336 TTGTATTTTTAGCAGAGAGAGGG + Intergenic
958933447 3:100232074-100232096 TTGTACTTTTAGCAGAGACAGGG - Intergenic
959447406 3:106457357-106457379 TTGACAGTCTACCAAAGAGAGGG - Intergenic
959560874 3:107779291-107779313 TTGCCCTTCAAGCACAGTGAAGG + Intronic
960112089 3:113855137-113855159 TTGTACTTCTAGTAGAGACAGGG - Intronic
960917553 3:122712418-122712440 TTTTTCTTTTAGCAGAGAGAAGG + Intronic
961125738 3:124416100-124416122 CACACCATCTAGCAGAGAGATGG + Intronic
961867471 3:129964186-129964208 TAGACTCTCCAGCAGAGAGATGG - Intergenic
962234490 3:133695418-133695440 TTGTATTTTTAGCAGAGAGAGGG + Intergenic
963490757 3:145997327-145997349 GTGAGCTTTCAGCAGAGAGATGG - Intergenic
963895757 3:150683579-150683601 TTGAATTTTTAGCAGAGACAGGG - Intronic
964255010 3:154766295-154766317 TTCATCTCCTAGCAGAGAGGAGG + Intergenic
964369851 3:155988482-155988504 TCCAGCTTCTAGCAGAGCGAAGG - Intergenic
964439981 3:156698214-156698236 TTGCACTTCTATAAGAGAGATGG - Intronic
964869184 3:161294290-161294312 CTGACCTTTGTGCAGAGAGAGGG + Intergenic
964996817 3:162892050-162892072 TTGAGCTTTCAGCAGAGAGGAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965767460 3:172145983-172146005 TTGTACTTTTAGCAGAGAGGAGG + Intronic
966069179 3:175854171-175854193 TTGTACTTTTAGCAGAGACAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966949645 3:184804529-184804551 TTGTACTTCTAACAGATAGAGGG + Intergenic
967125990 3:186425343-186425365 TTGAACTCCTAGAAAAGAGAAGG + Intergenic
968129792 3:196186346-196186368 TTGTACTTTTAGCAGAGACAGGG + Intergenic
969624898 4:8297461-8297483 CTTTCCTTCTAGCAGGGAGACGG + Intronic
969996115 4:11315058-11315080 TTGTACTTTTAGCAGAGACAGGG - Intergenic
970320687 4:14872588-14872610 ATGATCTTCTAGCACAGAGGTGG - Intergenic
970661032 4:18286090-18286112 TTGAGCTTCTAGCAGGTGGAAGG - Intergenic
974033727 4:56798913-56798935 TTGAATTTCTAGTAGAGACAGGG - Intergenic
976089057 4:81436109-81436131 TACAGCTTCTAGCAGGGAGATGG - Intronic
976408166 4:84682807-84682829 TTGTACTTCTAGTAGAGACAGGG - Intronic
977426716 4:96875844-96875866 TATACCTTCTGGCAAAGAGAAGG + Intergenic
977590157 4:98817283-98817305 TTGTATTTTTAGCAGAGAGAGGG - Intergenic
978194670 4:105957103-105957125 TTGAAGTTCTGGCAAAGAGAAGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980540989 4:134194701-134194723 TTAACCTTTTAACAGATAGAAGG - Intergenic
980826265 4:138077166-138077188 TTGTATTTTTAGCAGAGAGAGGG - Intergenic
981260401 4:142711873-142711895 TTGACTTTTTAGTAGAGACAGGG - Intronic
982158422 4:152542941-152542963 TTGTACTTTTAGTAGAGAGATGG - Intergenic
982469736 4:155773859-155773881 TTGTATTTTTAGCAGAGAGACGG + Intronic
982588420 4:157272628-157272650 TTGTGCTTCTGGCAGGGAGAGGG + Intronic
983307812 4:166015782-166015804 TTGACATTCCTGCTGAGAGAAGG + Intronic
983609185 4:169624304-169624326 TTGTCTTTTTAGCAGAGACAAGG + Intronic
984130390 4:175867954-175867976 TTGCTCTTCTGGCAGGGAGAGGG - Intronic
986131415 5:4935496-4935518 TTGAACTCCTAGTAGAGTGAAGG - Intergenic
986600750 5:9470146-9470168 TTGACTTACAAGGAGAGAGAAGG + Intronic
986837353 5:11653637-11653659 TTAGCCTTCTAGCAGATACATGG + Intronic
987422746 5:17739517-17739539 TTTACTTTCTATCAGAAAGAAGG - Intergenic
988666705 5:33336850-33336872 TTGACCTTCATGTAGAGATAAGG - Intergenic
988711387 5:33779769-33779791 TTGAACTTATAGGAGAGAGCAGG + Intronic
989013738 5:36904294-36904316 TTGAATTTTTAGCAGAGATAGGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990603135 5:57381435-57381457 TTGTCCATCTTTCAGAGAGAAGG - Intergenic
992041928 5:72843419-72843441 TTGAATTTTTAGCAGAGACAGGG - Intronic
992902811 5:81315944-81315966 ATTATATTCTAGCAGAGAGATGG - Intergenic
995722766 5:115153676-115153698 TTGTACTTTTAGCAGAGACAGGG + Intronic
996269652 5:121587772-121587794 TTGTACTTTTAGTAGAGAGAGGG - Intergenic
996702794 5:126466596-126466618 TTGTACTTTTAGCAGAGACAGGG + Intronic
999360741 5:150984548-150984570 TTGGCCATCTGGGAGAGAGATGG - Intergenic
1000039764 5:157476760-157476782 TTGAGGTTCTCTCAGAGAGATGG - Intronic
1000370064 5:160526926-160526948 CTGTCCTTCTTGCAGATAGAGGG + Intergenic
1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG + Intergenic
1003991199 6:11488139-11488161 TTGTACTTTTAGTAGAGAGAGGG - Intergenic
1004126974 6:12883385-12883407 TTGTATTTGTAGCAGAGAGAGGG + Intronic
1005128882 6:22480096-22480118 TAGTGCTTCTAGCAGAGGGAGGG + Intergenic
1006310907 6:33258738-33258760 TTGTACTTCTAGTAGAGACAGGG + Intronic
1006549204 6:34806830-34806852 TTGTACTTTTAGCAGAGACAGGG + Intronic
1006732776 6:36248689-36248711 TTGTACTTTTAGCAGAGACAAGG + Intronic
1007968175 6:46023130-46023152 TTGACCTTCCACCAGTGAAATGG + Intronic
1008548704 6:52606181-52606203 TTGTACTTTTAGCAGAGACAGGG + Intergenic
1008562476 6:52736216-52736238 TGGACCCTCTGGCAGAGAGAGGG - Intergenic
1008851915 6:56032739-56032761 TTGTGCTTCCAGCAGAGGGAGGG - Intergenic
1009351107 6:62680091-62680113 TTGTACTTCTAGTAGAGACAGGG - Intergenic
1009433623 6:63593341-63593363 TTGTACTTTTAGCAGAGACAGGG + Intergenic
1010726205 6:79336673-79336695 TTGAATTTCTAGTAGAGACAGGG + Intergenic
1010733522 6:79415633-79415655 TTGAACTTTTAGTAGAGACACGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1013204153 6:107931573-107931595 TTGTCTTTTTAGTAGAGAGAGGG - Intronic
1014151073 6:118055878-118055900 TTGCCCTCCTAGCAGGGAGCAGG - Intronic
1014289349 6:119540159-119540181 TTCAACTCCTAGCAGAGAGGAGG - Intergenic
1015372446 6:132469663-132469685 TTGTACTTTTAGCAGAGAAAGGG - Intronic
1015971305 6:138745367-138745389 TTGGCCTTGGATCAGAGAGATGG - Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1017817103 6:158023659-158023681 GTGAGCTTCCAGAAGAGAGAAGG - Intronic
1018575570 6:165256982-165257004 CTTACATTCTAGCAGAAAGAAGG + Intergenic
1018869722 6:167772104-167772126 TTGACCATCTACCAGGTAGAAGG + Intergenic
1019235131 6:170605535-170605557 TTGTACTTCTAGTAGAGACAGGG + Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019556472 7:1633950-1633972 CTGACATTCATGCAGAGAGAGGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1020907735 7:14085534-14085556 TTGACCTTCTAGGTCAGATAAGG + Intergenic
1022713903 7:32879647-32879669 TTGACCTTCCATCAGTAAGACGG - Exonic
1022727885 7:32997242-32997264 TTTACTTTTTAGCAGAGAGAAGG + Intronic
1022774392 7:33510304-33510326 TAGAACTTCAAGCAGACAGAGGG - Intronic
1022941473 7:35244725-35244747 CTGACCTTCTTGCATAGAAATGG + Intronic
1023824845 7:44002133-44002155 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1024185521 7:46944717-46944739 TTGTACTTCTAGCAGAGATAGGG + Intergenic
1024439510 7:49399721-49399743 TTTACCTTCTAGAAGAGACAAGG - Intergenic
1024636094 7:51291586-51291608 TTGTATTTTTAGCAGAGAGAGGG - Intronic
1025045766 7:55690774-55690796 TTTACTTTTTAGCAGAGAGAAGG - Intergenic
1026088394 7:67280907-67280929 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1026676132 7:72429991-72430013 TTGTCCTTTTAGTAGAGACAGGG + Intronic
1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG + Intergenic
1026920746 7:74153617-74153639 TTGTATTTTTAGCAGAGAGAGGG - Intergenic
1027117996 7:75496212-75496234 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027841423 7:83317132-83317154 CAGATCTTCTAGCAGATAGACGG - Intergenic
1029193867 7:98790727-98790749 TTGTACTTTTAGTAGAGAGAGGG - Intergenic
1029358806 7:100073068-100073090 CTCTCATTCTAGCAGAGAGATGG + Intronic
1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1029753108 7:102555438-102555460 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029771059 7:102654521-102654543 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029894734 7:103970981-103971003 TTGTACTTCTAGCAGAGACGGGG - Intronic
1030749637 7:113215645-113215667 CTGAGCTTCCAGCAGAGAGAAGG + Intergenic
1031863063 7:127005344-127005366 TTGACATTCTACCAGAGACCTGG - Intronic
1032113252 7:129094962-129094984 TTGTCCTTTTAGTAGAGACAGGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034752311 7:153582015-153582037 TTAACCTTTTATCAGATAGAAGG - Intergenic
1034810742 7:154129723-154129745 TTGTCTTTTTAGCAGAGACAGGG - Intronic
1036173474 8:6513505-6513527 TTGTACTTCTAGTAGAGACAGGG + Intronic
1037307077 8:17516394-17516416 TTGTACTTTTAGCAGAGACAGGG + Intronic
1037572308 8:20168740-20168762 TTGTACTTTTAGCAGAGACAGGG + Intronic
1037618270 8:20540830-20540852 TTGTACTTTTAGCAGAGACAGGG - Intergenic
1037764588 8:21764581-21764603 GGGTCCTTCTAACAGAGAGAAGG - Intronic
1038577705 8:28718969-28718991 TTGGCATTCTAGGAGAGAGATGG + Intronic
1038792391 8:30679875-30679897 TTGTATTTTTAGCAGAGAGAGGG + Intronic
1039259166 8:35751731-35751753 TTGGCATTCAAGAAGAGAGAAGG + Intronic
1039383094 8:37104006-37104028 TTGTCTTTTTAGCAGAGACAAGG + Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040837286 8:51745929-51745951 TTGTACTTTTAGTAGAGAGAGGG + Intronic
1041887790 8:62831817-62831839 CTGACCATCTAGCAGAGTTAAGG - Intronic
1042254118 8:66785903-66785925 CTGACTGTCTAGCAGAGTGAAGG + Intronic
1042406827 8:68415305-68415327 TTGTCCTTTTAGTAGAGACAGGG - Intronic
1042661465 8:71159198-71159220 TTGGTCTTCTACCACAGAGATGG - Intergenic
1043043279 8:75289131-75289153 TTGAGCTTTTAGCAGAGAGTAGG - Intergenic
1043207672 8:77467471-77467493 TTGAATTTTTAGTAGAGAGAGGG - Intergenic
1044387270 8:91603653-91603675 TTGTACTTCTAGTAGAGACAGGG - Intergenic
1047857530 8:128927918-128927940 TTGGCCTTTTAGTAGAGACAGGG + Intergenic
1048996533 8:139797430-139797452 TTGACTTTTTAGTAGAGACAGGG + Intronic
1049393202 8:142382576-142382598 GGGACCTCCTGGCAGAGAGAAGG + Intronic
1049948670 9:623151-623173 TTGACCTTTTACCAGATATATGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050886191 9:10769383-10769405 TTAACCTTCTATCAGATATATGG + Intergenic
1051560692 9:18437478-18437500 TTGGCCCTGTAGCAGTGAGAAGG - Intergenic
1053086743 9:35230678-35230700 TTGACCTACTAGGAAAGATAAGG - Intronic
1055206363 9:73735534-73735556 TTAACATTTTAGAAGAGAGAAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058365712 9:104206144-104206166 TTGTGCTTCCAGCAGAGGGAGGG + Intergenic
1058369410 9:104247902-104247924 ATGATTATCTAGCAGAGAGAAGG + Intergenic
1059126707 9:111695073-111695095 TTGACATTTCAGAAGAGAGAAGG - Intronic
1060386602 9:123235193-123235215 TTGGCCTTCTACCACAGACAAGG - Intronic
1061127268 9:128684751-128684773 GTGACTTTCCAGCAGAGAGCTGG - Intronic
1185773829 X:2786438-2786460 TTGTACTTTTAGCAGAGACAGGG + Intronic
1185783400 X:2868333-2868355 TTGTATTTCTAGCAGAGACAGGG - Intronic
1186289602 X:8082129-8082151 TTGTACTTCTAGTAGAGACAGGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187381398 X:18805157-18805179 TTGAACTTTTAGTAGAGACAAGG + Intronic
1188310596 X:28612284-28612306 TTGACCTTCTTTCAAAGAAAGGG + Intronic
1188941318 X:36241341-36241363 TAGAGCTTCTAGAAGGGAGATGG - Intronic
1190328277 X:49219878-49219900 CTGACATTCTAGCAGGGAAATGG - Intronic
1190772072 X:53523476-53523498 TTGAACTTTTAGTAGAGACAAGG - Intergenic
1196423843 X:115549891-115549913 TTGTACTTTTAGCAGAGACAGGG - Intergenic
1196991330 X:121331934-121331956 TTGTACTTTTAGTAGAGAGAGGG - Intergenic