ID: 947009273

View in Genome Browser
Species Human (GRCh38)
Location 2:225547616-225547638
Sequence AAGGAGAGTATAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 2, 2: 26, 3: 92, 4: 329}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947009273_947009282 22 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009282 2:225547661-225547683 ATGCCATGTGGCCACTGCTGGGG 0: 3
1: 7
2: 25
3: 79
4: 306
947009273_947009283 23 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009283 2:225547662-225547684 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371
947009273_947009287 29 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009287 2:225547668-225547690 GTGGCCACTGCTGGGGGATGGGG 0: 5
1: 13
2: 29
3: 143
4: 644
947009273_947009280 20 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009280 2:225547659-225547681 TCATGCCATGTGGCCACTGCTGG 0: 1
1: 3
2: 8
3: 55
4: 381
947009273_947009279 10 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009279 2:225547649-225547671 CACGGATTCTTCATGCCATGTGG 0: 1
1: 0
2: 4
3: 7
4: 79
947009273_947009275 -8 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009275 2:225547631-225547653 CTCTCCTTCTGCCAAGTCCACGG 0: 1
1: 0
2: 2
3: 25
4: 300
947009273_947009285 27 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009285 2:225547666-225547688 ATGTGGCCACTGCTGGGGGATGG 0: 4
1: 8
2: 29
3: 156
4: 609
947009273_947009286 28 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009286 2:225547667-225547689 TGTGGCCACTGCTGGGGGATGGG 0: 4
1: 14
2: 24
3: 103
4: 431
947009273_947009281 21 Left 947009273 2:225547616-225547638 CCCACAATCACTATACTCTCCTT 0: 1
1: 2
2: 26
3: 92
4: 329
Right 947009281 2:225547660-225547682 CATGCCATGTGGCCACTGCTGGG 0: 2
1: 8
2: 25
3: 62
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947009273 Original CRISPR AAGGAGAGTATAGTGATTGT GGG (reversed) Intronic
900759652 1:4462232-4462254 AAGGAAAGTAAAGTGAGTGGTGG - Intergenic
902157696 1:14502950-14502972 CAGGAGAGAAGAATGATTGTGGG - Intergenic
903642447 1:24869193-24869215 AAGGAGAGTGTTGGGATGGTGGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907686992 1:56621977-56621999 AAACAGACTATAGGGATTGTTGG + Intronic
908022732 1:59915127-59915149 CAGGAGAGCAGAGTGATAGTGGG - Intronic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
908913922 1:69104214-69104236 AAGTAGAGTATAGAGAGTGAAGG - Intergenic
909235718 1:73150986-73151008 AAGGAGAGTATATCGTTTGTAGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912022643 1:105124509-105124531 AAATAAAGTATTGTGATTGTGGG - Intergenic
912230564 1:107787950-107787972 AAGGAGAGGAGTGGGATTGTGGG - Intronic
912332183 1:108830111-108830133 AAGGAGAGAGTAGGGATGGTGGG + Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918402634 1:184178720-184178742 AAGGAGATCAGAGGGATTGTTGG - Intergenic
918523411 1:185439538-185439560 AAGGAGAGGATAGAGAAGGTGGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
1062795158 10:339436-339458 AAAGAGTGTATTGTTATTGTGGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1066556906 10:36624241-36624263 AAGTAGAGTAGAGAGATTGGGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068353510 10:55880965-55880987 CTAGAGAGTATAGTGAGTGTTGG - Intergenic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1070731987 10:78835683-78835705 AAGGAGAGAATAGTCAGTATTGG + Intergenic
1072068196 10:91890624-91890646 AAGGACAATATAGTGAATTTTGG - Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073605355 10:104889621-104889643 AAGGAGAGTATACTGTTTTAGGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075019201 10:118937232-118937254 CAGTAGAGTTTAGTGATTCTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075904743 10:126071486-126071508 AAGGAGAGGAGTGTGACTGTGGG - Exonic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079724676 11:23866398-23866420 AAGTAGAGTTTATTGGTTGTAGG + Intergenic
1079950006 11:26790289-26790311 AAGGAGGTTATGGTGATGGTAGG + Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084110266 11:67009752-67009774 AAGGAGAGTCCAGCTATTGTGGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1087015174 11:93547765-93547787 AAAGAGAATATAATGAGTGTAGG + Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088177589 11:107071868-107071890 AGGGTGTGTATAGTGACTGTTGG - Intergenic
1088229546 11:107659743-107659765 AAGGAGAGTCTAGTTTCTGTGGG + Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088705398 11:112458152-112458174 AAGGTGTATTTAGTGATTGTAGG + Intergenic
1088854816 11:113739023-113739045 AAGGTGAGTGTAGTCTTTGTGGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089474842 11:118751004-118751026 AAGGGGATTAGAGTGATTATGGG - Exonic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1093269210 12:17038137-17038159 AAGGAAAGAATACTGATAGTTGG - Intergenic
1095747591 12:45676785-45676807 AAGTAGAGGGTAGTGATTCTGGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1100331774 12:93589458-93589480 AAAGTGAGTTTAGTGATGGTGGG + Intergenic
1100696271 12:97097527-97097549 AAAGGTAGTATAGTGATTATAGG + Intergenic
1102621514 12:114198958-114198980 AAAGAGAGAATACTCATTGTAGG + Intergenic
1103470946 12:121180634-121180656 AAAGAGAGGGTAGTGATTGGAGG - Intronic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1107302035 13:38976150-38976172 AAGGAGAGTATATTGAGAGCTGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108315301 13:49231056-49231078 AAAGATGTTATAGTGATTGTTGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1110087998 13:71406691-71406713 ATGGGGATTATAGGGATTGTAGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110580351 13:77115148-77115170 AAGGAGTGTTTATTGACTGTAGG - Intronic
1110880486 13:80566376-80566398 AAAGAGAGAATACTGATTTTTGG - Intergenic
1111296012 13:86278664-86278686 AAGGAGATTAGAGTGATTATAGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111947706 13:94682869-94682891 AAGGAGATTGTAGTGTTTGGTGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1115440513 14:33429624-33429646 AAGAACAGTATACTGATTTTAGG + Intronic
1116050112 14:39791959-39791981 TAGAAGAGTATATTGCTTGTGGG + Intergenic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119753158 14:77095031-77095053 AAAGAGAGTAAAGTGAGTGAAGG + Intergenic
1120012362 14:79431386-79431408 ATAGAGAGTATATTAATTGTTGG + Intronic
1121223796 14:92306571-92306593 AAGGAGAGAATAGATTTTGTTGG - Intergenic
1121509069 14:94498941-94498963 AAGGAGAGGAGAGTGATAGAGGG + Intronic
1123136409 14:106031449-106031471 TAGGAGAGTAGGGTGATAGTGGG + Intergenic
1124582594 15:30973289-30973311 TAGCAGAGTAGAGTGGTTGTAGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1134796165 16:17038963-17038985 AAGGAGAATGTAGTGCATGTGGG - Intergenic
1137329850 16:47482324-47482346 AAGGACAGTACAGAGTTTGTAGG - Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140875550 16:79149497-79149519 AAGGAAAGCATACTGTTTGTTGG + Intronic
1141401734 16:83753641-83753663 AAGGAGAGAATAAGGATTTTTGG + Intronic
1141450659 16:84099033-84099055 AATGTGAGTATTGTGACTGTAGG - Exonic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143418444 17:6768965-6768987 AAGGAGAGTTGAGAGAATGTGGG - Intronic
1145183977 17:20778521-20778543 ATGGGGATTATAGTGATTATGGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1149044386 17:52227320-52227342 AAGGAGAGAATGGGTATTGTGGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149911614 17:60572067-60572089 AAGAAGAGTATACTTATTCTGGG + Intronic
1150013142 17:61525023-61525045 CAGGTGTGAATAGTGATTGTAGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1150940576 17:69688868-69688890 GAGGAGAGAATAATGATGGTTGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156495281 18:37521351-37521373 GAGGAGAGAATAGAGAGTGTGGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158225113 18:55192745-55192767 AAGGAGATTAAAGTGACTGAGGG + Intergenic
1159122695 18:64189381-64189403 AAGAAGAGTGTACTGTTTGTTGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159513600 18:69428732-69428754 AAGGAGAATAGAGAGGTTGTTGG - Intronic
1164713614 19:30376234-30376256 AAGGCGTGTATAGGGATTGGGGG - Intronic
1164731627 19:30509719-30509741 AAGAAAAGTGTACTGATTGTGGG - Intronic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
926000449 2:9327369-9327391 AAGGAAAATAATGTGATTGTTGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928574055 2:32636919-32636941 GAGGACAGCATAGTGTTTGTGGG + Intronic
928982085 2:37146481-37146503 AAAGAGATGAAAGTGATTGTAGG - Intronic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929320496 2:40538320-40538342 AGGGAGAGTATTTTCATTGTGGG - Intronic
929711547 2:44271741-44271763 CAGGAGAATATAGGGATTGGAGG - Intergenic
930049357 2:47202657-47202679 AAATAGAGTCTAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
932985360 2:76720135-76720157 AAGGAGAGAATAGTTACTGCAGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937678428 2:124617801-124617823 AAGGTGTGCATAGTGCTTGTTGG + Intronic
938945663 2:136209892-136209914 AATGAAAGTTTAGTGATTATTGG + Intergenic
939066929 2:137494835-137494857 AATGAAAGTATACTGTTTGTGGG - Intronic
940018003 2:149126796-149126818 AAGGAGAGAATAGAGAATGGAGG - Intronic
940218906 2:151330253-151330275 TAGGAAAGTATAGAGATGGTAGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942399361 2:175585047-175585069 AAGGAGAGTACAGATATTGAGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945738303 2:213629487-213629509 AAGGAGAGAATCCTGATTGGTGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948103043 2:235390546-235390568 TAGGAGAGTCAAGTGAATGTGGG - Intergenic
948362385 2:237432237-237432259 AAGGAGAGGATGTGGATTGTTGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170062648 20:12275854-12275876 AAGAAGAGTACAATTATTGTAGG + Intergenic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1174690932 20:52503813-52503835 AAGAAGAGTGTGGTGACTGTGGG + Intergenic
1175049625 20:56142656-56142678 AAGGAAAGTCTAGTGATTAGTGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1178166947 21:29990001-29990023 ATGGAGAGATTAGTGTTTGTTGG + Intergenic
1185053776 22:48567479-48567501 AAGGAGAGCAGGGTGATCGTGGG + Intronic
949978377 3:9481605-9481627 GAGGAGAGCATAGTCATTGAAGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952859843 3:37803940-37803962 AAGGTGAGTCTGGTGATTGCAGG + Exonic
954105683 3:48408732-48408754 AAGGTGAGTCTGGTGTTTGTGGG - Intronic
954299564 3:49692613-49692635 AAGGGTAGTATAGGGCTTGTGGG - Intronic
954595707 3:51822327-51822349 AAAGAGAAAATAGTGAATGTTGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956281857 3:67566041-67566063 AAGGAGAGTATAGCGGTGGAAGG + Intronic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
958161872 3:89827471-89827493 AAGCAGGGTATAGTTATTCTAGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
958867058 3:99513381-99513403 AAAGAGAGTATACTGGTAGTTGG + Intergenic
959120961 3:102231541-102231563 AAGGGGACTATGGTCATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959644199 3:108679149-108679171 AAGGACAGTATTTTGAATGTGGG - Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960931696 3:122857672-122857694 AAGGGGAATATAGTATTTGTAGG + Intronic
962140166 3:132781980-132782002 AAGGAGAGAATGGACATTGTGGG - Intergenic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964216188 3:154286195-154286217 ATTGAGAGTAAAGTGTTTGTTGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964652617 3:159028397-159028419 AAGAAGATTTTAGTGATTTTAGG - Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965529915 3:169761042-169761064 ATGGAGACTATAGAGATGGTAGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966556201 3:181262910-181262932 AATGAGTGTATAGTCATTTTAGG + Intergenic
966698298 3:182816220-182816242 AAGTAGAGTTTAGGTATTGTAGG - Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968152746 3:196351392-196351414 GAGGAGAGTATAGTAGTTATAGG - Exonic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
977632137 4:99254897-99254919 AAGGAGAGTAGAATGAGTGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978771229 4:112458054-112458076 AAGCAAAGTATAGAGATGGTAGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979952969 4:126918059-126918081 TAGAAAAGTATAGTGATTCTGGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983020117 4:162665662-162665684 AAGGGGAGTTTATTGAGTGTTGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987169682 5:15240923-15240945 AAGGAGATTATTGTGGTTTTAGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988013592 5:25523469-25523491 GAAGAAAGTATAGTAATTGTAGG + Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
989438816 5:41446206-41446228 AACGAGAGAATAGTGAGGGTTGG + Intronic
989806801 5:45618374-45618396 TAGAAGCCTATAGTGATTGTGGG + Intronic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
991190438 5:63866791-63866813 AAGGAGAGTTTAGCAAATGTTGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991959096 5:72023759-72023781 AAGGAAAGCATATTGATTTTTGG + Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992657112 5:78921909-78921931 AAGGAAGGTGTAGCGATTGTGGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1005793155 6:29328261-29328283 AAGGGGATTAGAGTGATTATGGG - Intergenic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1008212718 6:48744975-48744997 AAGCAGAGGTTATTGATTGTAGG + Intergenic
1008504341 6:52214901-52214923 AAGGACAGTAAATTGATTATAGG + Intergenic
1009026776 6:58009561-58009583 AAGAAGAGTAAAGGTATTGTGGG + Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016354084 6:143198892-143198914 AAGGAGAAAAGAGAGATTGTGGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017281036 6:152626197-152626219 ATGAAGAGTAGAGTGTTTGTAGG + Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022296614 7:29061533-29061555 AAGGAGAATATATTGATTAGAGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023066680 7:36384876-36384898 AAGGAAAGTATTGTGATGTTAGG + Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1026073845 7:67147799-67147821 AAGGGGAGAATAGGGATTGGTGG + Intronic
1026703038 7:72664387-72664409 AAGGGGAGAATAGGGATTGGTGG - Intronic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027858651 7:83546374-83546396 GAGGGGAATATAGTGAATGTGGG + Intronic
1027889738 7:83956543-83956565 AAGGAAGGTAAAGAGATTGTGGG + Exonic
1028123092 7:87079040-87079062 AAGGAGAATATACTGAGTTTTGG - Intergenic
1028461227 7:91095313-91095335 GGTGAGAGTATAGTGAATGTGGG + Intronic
1028891592 7:95994060-95994082 AAGGACTCTATAGTGATTCTAGG - Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029530202 7:101120453-101120475 AATGAGAGAATAGTGATCATTGG - Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1032548492 7:132762909-132762931 AAGGAGAGGATGGAGAGTGTGGG - Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034925762 7:155120149-155120171 AGAAAGAGTATAGTGATTGCAGG - Intergenic
1035517275 8:246127-246149 AAGGACAGAAGAGTGATTGAAGG - Exonic
1036707873 8:11058865-11058887 AAGGAATGTATAGTCACTGTGGG + Intronic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1040962707 8:53051862-53051884 TAGGAGAGCATGGTGAGTGTTGG + Intergenic
1042578347 8:70248397-70248419 AATCAGAGTATCGTGGTTGTTGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1044328603 8:90890164-90890186 AAGGGGATTATGGGGATTGTAGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044560060 8:93604068-93604090 AAGTAGATTAAGGTGATTGTGGG - Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047273495 8:123386034-123386056 AAGGAGAAAATAGCAATTGTTGG + Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056368392 9:85929374-85929396 AAGGAGAGGCTAGTGAGGGTTGG + Intergenic
1057084509 9:92196686-92196708 AAGGAAAGTGAAGTGAGTGTAGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1185755848 X:2652309-2652331 AAGGAGACTACAGTGTTTGGGGG + Intergenic
1186602260 X:11050303-11050325 AAGGAGAACATAGTGATCATGGG - Intergenic
1186939542 X:14490103-14490125 AAGGAGAGGATACTGACTGATGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188197159 X:27250829-27250851 AAGGAGAGGATAAAGATAGTGGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188461935 X:30437632-30437654 AAGGATGGTTTGGTGATTGTAGG - Intergenic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194665539 X:96673699-96673721 AAGGAGAGTGTAGAGTTTATGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200329333 X:155279827-155279849 GAGGAGAGTATAGAGAATGAGGG + Intronic
1201557963 Y:15284314-15284336 AAAGATAGTTTAGTGATTGCAGG + Intergenic
1201625805 Y:16013026-16013048 ATGGAGATTATAGTAATTATAGG - Intergenic