ID: 947012824

View in Genome Browser
Species Human (GRCh38)
Location 2:225584281-225584303
Sequence TTCTGTAAGTTATATATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947012824_947012826 -8 Left 947012824 2:225584281-225584303 CCATCAATATATAACTTACAGAA 0: 1
1: 0
2: 3
3: 30
4: 320
Right 947012826 2:225584296-225584318 TTACAGAAAAGTCACTAAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 257
947012824_947012827 29 Left 947012824 2:225584281-225584303 CCATCAATATATAACTTACAGAA 0: 1
1: 0
2: 3
3: 30
4: 320
Right 947012827 2:225584333-225584355 ACTACTGAATTTCAAAGACCAGG 0: 1
1: 0
2: 1
3: 23
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947012824 Original CRISPR TTCTGTAAGTTATATATTGA TGG (reversed) Intronic
901741035 1:11342070-11342092 TTTTGTAAGTTATAAAGTCATGG - Intergenic
905834072 1:41101584-41101606 TTCTGTGAATTATAAATTTAAGG - Intronic
906338215 1:44953088-44953110 TTTTGTATGTTCTATACTGACGG - Intronic
907944246 1:59119339-59119361 TTCTGTAAGATGTGTAATGATGG + Intergenic
908798162 1:67852057-67852079 TTATGTAAATTTTATATTGTAGG + Intergenic
909002057 1:70229972-70229994 TTCTGTAAATTTTCTGTTGATGG - Intronic
910044798 1:82899525-82899547 TTCTGAAAGTGACATATTTATGG + Intergenic
910644983 1:89504797-89504819 TTCTGTACGTCATCTATTGAGGG - Intergenic
911653810 1:100419724-100419746 TTCTGGAAATTGTATTTTGAAGG + Intronic
912093798 1:106114643-106114665 TTCAGTAAATTAGGTATTGATGG + Intergenic
916518449 1:165541780-165541802 TTCTGTCATCTACATATTGAGGG - Intergenic
916520884 1:165562687-165562709 TTCTTTCTGTTATATAGTGAAGG + Intronic
918592787 1:186258770-186258792 TTCAATAAGTTAGGTATTGATGG - Intergenic
920724811 1:208424398-208424420 TTCTGTAACTTAAAGCTTGAAGG + Intergenic
921361100 1:214331892-214331914 TTCTGTAAGTTACTTTTTCATGG + Intronic
921839826 1:219816620-219816642 TTCTGGCAGTTATTTGTTGAAGG - Intronic
921847681 1:219901379-219901401 TTCTCTGTGTTTTATATTGAAGG - Intronic
922268114 1:224006454-224006476 TTCAGTGAGTTTTATATAGAAGG + Intergenic
922293212 1:224226178-224226200 ATCCGGAAGTTATATATAGATGG - Intergenic
922312773 1:224411485-224411507 TTCTGTAAATTCTCTAATGATGG - Exonic
923001589 1:230010474-230010496 TTATGTAAGTTATGTATGGTTGG - Intergenic
923951446 1:238960064-238960086 TTTTGTAAGTAAAATACTGAGGG + Intergenic
923982829 1:239344847-239344869 TTATGTAATATCTATATTGAAGG + Intergenic
924109007 1:240679310-240679332 TCCAGTAAATTAGATATTGAAGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063174241 10:3537343-3537365 TTGTGTCAGTTATCTATTTAGGG + Intergenic
1064113893 10:12561246-12561268 TGCAGTAAGTTATTTAGTGATGG + Intronic
1064628395 10:17284614-17284636 TTCTGTGAGATATTTATTGGGGG + Intergenic
1065539429 10:26746318-26746340 TTCTGTATCTTATAGAGTGATGG + Exonic
1065935145 10:30514628-30514650 TTCTGTAAGTTTTGTAGAGATGG + Intergenic
1066643888 10:37585408-37585430 TTCTGAAAGTTGTATATAAATGG - Intergenic
1069138200 10:64791559-64791581 ATGTGTAAGTTATTCATTGATGG - Intergenic
1069203181 10:65648922-65648944 TTCAGTAAGTTATATTTTTCAGG - Intergenic
1070188406 10:74088623-74088645 TTTTCTAACTTATATAGTGAAGG - Intronic
1073469345 10:103713173-103713195 CTCTGTAAGTTGGATCTTGAGGG - Intronic
1074296628 10:112195260-112195282 ATCTGTAAGGAATATATGGAAGG - Intronic
1074779219 10:116788670-116788692 TTCTCTTAATTATATATTGTGGG + Intergenic
1075360665 10:121829973-121829995 TTCTGTGAGTTATTTCTTGCTGG + Intronic
1076553832 10:131308524-131308546 TTCTTTAAGTTTTAGAATGATGG - Intronic
1077978631 11:7276090-7276112 TTCTGTATGTTTTATCTTCATGG + Intronic
1079675745 11:23224312-23224334 TTCTTTATGTTATATTTTAAAGG - Intergenic
1080075884 11:28148919-28148941 TGCAGTAAGTTATAAATTAATGG - Intronic
1082210616 11:49496878-49496900 TTTTTTAAATTATATTTTGATGG - Intergenic
1082247917 11:49946251-49946273 CTCAGTAAGTTAGGTATTGATGG - Intergenic
1085247040 11:75110237-75110259 TTGTGCAAGTGATTTATTGAGGG + Intronic
1085925172 11:81009639-81009661 TTCTGTAAGTTGCCTATTTAGGG + Intergenic
1086639016 11:89127914-89127936 TTTTTTAAATTATATTTTGATGG + Intergenic
1086727528 11:90206685-90206707 TTCTGGAAGTTCTAGAGTGATGG + Intronic
1087709817 11:101535539-101535561 TTCTGTATGTTCTATATTTGAGG - Intronic
1090166542 11:124554897-124554919 CTCAGTAAATTAGATATTGATGG + Intergenic
1090537171 11:127655953-127655975 TTCTGTAAGCTAAATGTTAATGG - Intergenic
1091203678 11:133802140-133802162 TTATGCAAGGTATTTATTGAGGG - Intergenic
1091809268 12:3381225-3381247 TTCTGTAAGAAATATTTTTAAGG + Intergenic
1092661682 12:10745436-10745458 CTCAATAAGTTAGATATTGATGG - Intergenic
1093438049 12:19160013-19160035 TTCTGTGATTTATTTGTTGATGG + Intronic
1093503679 12:19839773-19839795 TTCTTTAAGATAGATAGTGACGG + Intergenic
1093659363 12:21736563-21736585 TTTTGCAAGTTGTTTATTGAGGG + Intronic
1095660408 12:44726111-44726133 TTTTTTAAATTATTTATTGAAGG - Intronic
1097626590 12:62009673-62009695 TTCTGTGAGTAATAAATGGATGG - Intronic
1099170471 12:79358204-79358226 TTCTGAAAGTTTTCTATTTAAGG + Intronic
1099489087 12:83266080-83266102 TTCTGTATCTGAAATATTGATGG - Intergenic
1100240455 12:92706023-92706045 TTCTGTAATTTAAACCTTGAGGG + Intronic
1100418504 12:94404910-94404932 TTCTGTACCTTATTTATTGAAGG + Intronic
1106201784 13:27544243-27544265 TTCAGTAAGTTACACATTTATGG - Intergenic
1107268125 13:38581804-38581826 TCATGGAAGTTCTATATTGATGG - Intergenic
1107364410 13:39655332-39655354 TTTTGAAAATTATTTATTGAAGG - Intergenic
1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG + Intergenic
1108296494 13:49024701-49024723 TTCTGTACCTAATTTATTGAGGG - Intronic
1109283246 13:60381240-60381262 CTTTGAAAGTAATATATTGAGGG - Intergenic
1109989619 13:70037811-70037833 TTCTTAAAGTTATATGTTGAGGG + Intronic
1110090851 13:71445959-71445981 GTCTGTATGTTATATAATAATGG + Intronic
1110686659 13:78383489-78383511 GTCTGTATGTTACTTATTGAGGG + Intergenic
1111380082 13:87438506-87438528 CTCAGTAAATTAGATATTGATGG + Intergenic
1111409083 13:87851036-87851058 TTATGAAAGTTATTTAATGAGGG + Intergenic
1111882932 13:93980909-93980931 TTGTGCAAGTGATTTATTGAGGG - Intronic
1112750934 13:102582677-102582699 TTTTTTAAAATATATATTGAGGG - Intergenic
1113322796 13:109252928-109252950 TCTTGTAAATTATATTTTGAAGG + Intergenic
1115343817 14:32320757-32320779 TTCAGTAATTAATATATTAAAGG - Intergenic
1115542857 14:34439014-34439036 TTGTGCAAGCTATTTATTGAGGG + Intronic
1116397321 14:44462305-44462327 TTGTTCAAGTTATTTATTGAAGG + Intergenic
1117207220 14:53456137-53456159 TTCTTTAAGTTCCAAATTGAGGG - Intergenic
1117733267 14:58745286-58745308 TTCTGAAAGTAAGAGATTGATGG - Intergenic
1118625223 14:67652685-67652707 TTCTGGAAGTTCTATATTGTAGG - Intronic
1119917186 14:78413097-78413119 TTCTTTAAGTGATTTGTTGAGGG + Intronic
1120043165 14:79776535-79776557 TCCTGGAAATTATATATTGGAGG + Intronic
1125067360 15:35504331-35504353 TTCTATATGGAATATATTGATGG - Intronic
1125959421 15:43816735-43816757 TTTTGTATGTTATATATTGATGG - Intronic
1126732234 15:51695538-51695560 TTTTGTAAGTTAAATATATATGG + Intronic
1126741028 15:51776154-51776176 TACTGTAAGCTACATATTGAAGG - Intronic
1127088995 15:55448083-55448105 CTCAGTAAGCTAGATATTGATGG - Intronic
1127189200 15:56511698-56511720 CTCAGTAAATTATGTATTGATGG - Intergenic
1127914248 15:63442331-63442353 TTCTGTAAGTTAGGTGTTGAAGG - Intergenic
1129564278 15:76605195-76605217 TTCAATAAGTTAGGTATTGATGG - Intronic
1131509735 15:93043448-93043470 TACTGTAAATTATTTATTAATGG - Intronic
1131859599 15:96638282-96638304 TTCTGAAAGTCATATATACATGG - Intergenic
1132917684 16:2361737-2361759 TTCTATAAGTGAAACATTGAAGG + Intergenic
1135601472 16:23787460-23787482 TCCTGTGAGTAATATCTTGATGG - Intergenic
1137992406 16:53172254-53172276 TTCTGGAATTTATATATAAATGG + Intronic
1138051027 16:53778633-53778655 TTTTATTAGTTATATCTTGAAGG + Intronic
1138827928 16:60343211-60343233 TTCTGCAAGTGATACAATGAGGG + Intergenic
1139084465 16:63567611-63567633 TTGTGAAAGTGATTTATTGAAGG + Intergenic
1139162222 16:64524472-64524494 TTCTGAAACTTATACATTGTTGG + Intergenic
1141004480 16:80339538-80339560 TTATGCAAATTAGATATTGATGG - Intergenic
1141220911 16:82068574-82068596 TTCTGTAAGTTCTGTGTGGATGG - Intronic
1143384015 17:6515712-6515734 TTCTGTAGGTTAGATATGGGTGG - Intronic
1149022934 17:51991220-51991242 TTCAGTAGGAAATATATTGAAGG - Intronic
1153188467 18:2512011-2512033 TTTAGAAAGTTATATATTGAGGG - Intergenic
1153419476 18:4888114-4888136 TTCGGTAAATAATGTATTGAAGG - Intergenic
1153871709 18:9327063-9327085 TTATGTTTGTTATAAATTGAAGG + Intergenic
1154368750 18:13737791-13737813 TTCTGAAACTTATAAATTAAGGG + Intronic
1155323404 18:24642098-24642120 TTTTATAAGTTGTAAATTGAAGG - Intergenic
1155677377 18:28446164-28446186 TTCTGTTACTTATATTTTGGGGG - Intergenic
1155785937 18:29899333-29899355 TACTGTTAGGTATATATTTATGG + Intergenic
1158869681 18:61673449-61673471 TTCTTTTACTTATATATTGGTGG - Intergenic
1159513646 18:69429594-69429616 TTCTATAAGGAAAATATTGAGGG + Intronic
1159804921 18:72944653-72944675 TTCTTACACTTATATATTGATGG - Intergenic
1163181296 19:15605674-15605696 TTCTGTACATTTTAAATTGATGG - Intergenic
1164123289 19:22287220-22287242 TTTTGTAAATTATACATTGGGGG - Intronic
1164841456 19:31395990-31396012 CTCTGTAAGTCATATCTTAAAGG - Intergenic
1165547533 19:36553628-36553650 CTCTACAATTTATATATTGATGG - Intronic
925062025 2:898733-898755 TTCTATAAAATATAAATTGATGG + Intergenic
925179754 2:1809462-1809484 CTCTGAAAGTTATACAATGAAGG - Intronic
926448183 2:12970156-12970178 TTCTGTGAGTTAAATATAGGTGG - Intergenic
928345607 2:30491782-30491804 TTTTGTAAGTTATATGTAGATGG + Intronic
928475298 2:31620154-31620176 CTCAGTAAACTATATATTGAAGG + Intergenic
929297271 2:40262474-40262496 TTGTTTAAGTTAGATATTGCTGG - Intronic
930213065 2:48663261-48663283 TTTTGTATTTTTTATATTGATGG - Intronic
930991197 2:57656893-57656915 TTTTGTAAGTTTTATATGAAAGG + Intergenic
931190401 2:59994880-59994902 TTCTGTAATTTATAGTTTAATGG + Intergenic
932905298 2:75742941-75742963 TTCTGTACCTAATTTATTGAGGG - Intergenic
933099486 2:78234551-78234573 TTCTATAACTTTTATAGTGAAGG - Intergenic
933252497 2:80044660-80044682 TGCTGTAAGTTCCATAATGAAGG - Intronic
933415037 2:81976808-81976830 TTTTATAAGTTTTATATTTATGG - Intergenic
934486724 2:94721747-94721769 TTCTGTTTCTTATATATTGCTGG - Intergenic
935167628 2:100583082-100583104 TTCTGTTAGTTATTTTTTTAAGG - Intergenic
937190589 2:120093658-120093680 TTCTTTATGTTATATGTTGCTGG + Intronic
939487532 2:142833802-142833824 TTCTAGAAGTTTTATATTTATGG - Intergenic
939974524 2:148701964-148701986 TTCTGTAAGTTGTCAATTTATGG + Intronic
940309893 2:152267359-152267381 TTCTTTATGTTATATATATATGG + Intergenic
940318971 2:152354347-152354369 TTGTGTAACTTGTATATAGATGG + Intronic
940553915 2:155197904-155197926 TTCTGTAAATTCTATATTCTTGG - Intergenic
941332001 2:164189963-164189985 TTCAGTAAGGTATGTACTGATGG + Intergenic
941538451 2:166752179-166752201 TTCTGTTACTTATCAATTGAAGG - Intergenic
942365291 2:175219887-175219909 TTCTGGACGTTTCATATTGAAGG - Intergenic
942559035 2:177200938-177200960 TTCAGCAAGTGATATATTAAAGG + Intergenic
943083342 2:183282847-183282869 TACTCTAAGTTATTTATTCAAGG - Intergenic
943425742 2:187731301-187731323 TTCTGTATCTAATATATTGCTGG - Intergenic
943790296 2:191923706-191923728 TTCTGTAATTCATTTATTTAGGG + Intergenic
943810243 2:192177389-192177411 TTCTTTAAATTCTTTATTGAGGG - Intronic
945424509 2:209683651-209683673 TGCTATAAGCAATATATTGATGG - Intronic
945651360 2:212564315-212564337 TTCTGTTAGGTATATGTTGGGGG - Intergenic
945787783 2:214264710-214264732 TTCTGTATGTTATATAATGATGG - Intronic
945874226 2:215261152-215261174 TTCTGTAAATTATATTTTCTAGG - Intergenic
946810257 2:223516068-223516090 TTCAGTTAGTTATTTATTAACGG - Intergenic
947012824 2:225584281-225584303 TTCTGTAAGTTATATATTGATGG - Intronic
947264310 2:228260262-228260284 TTCTGTTAGTGATAGATTGAGGG + Intergenic
948971205 2:241428494-241428516 TACTGAAAGTAAAATATTGAAGG - Intronic
949061900 2:241965140-241965162 TTCTTTAAGTTATATTTGTATGG + Intergenic
1169878748 20:10324567-10324589 TTGTGTAAGTGATTTATTTAGGG - Intergenic
1170055849 20:12201663-12201685 TTTTGCAAGTGATTTATTGAGGG - Intergenic
1173092440 20:39985961-39985983 TTTTGAACCTTATATATTGAGGG + Intergenic
1173095453 20:40023534-40023556 TTGTGTAAGTGACATATTGAGGG - Intergenic
1173477278 20:43369545-43369567 TTCAATAAGTTAGATATTGATGG + Intergenic
1173573545 20:44094685-44094707 TTATGTAAGTGATATCATGACGG + Intergenic
1173577193 20:44120119-44120141 TTGTGTAAGTGATTTACTGAGGG - Intronic
1177860694 21:26449905-26449927 TTCTGGATTTTATATATAGATGG + Intergenic
1178068343 21:28932944-28932966 TTCTGTCACTTATCTATTCAAGG - Intronic
1178332988 21:31716757-31716779 TTTAGTAAATTATATATTGAAGG - Intronic
1179137524 21:38693278-38693300 TTGTGCAAGTAATTTATTGAGGG - Intergenic
1179286450 21:39981622-39981644 TTCTGAGAGTTATTCATTGAGGG + Intergenic
1179708985 21:43201106-43201128 TTCTTTAAATTATTTATTAAGGG - Intergenic
1180256191 21:46629479-46629501 TTCTGGATTTTATATTTTGAAGG + Intergenic
1180646434 22:17343005-17343027 TTTTGTATGTTATGTAGTGATGG + Intergenic
1182940686 22:34273917-34273939 TTCTGTAAGATATATATCTAGGG - Intergenic
1184891152 22:47380139-47380161 TTCTGCAAGTTAGATTTTGGAGG + Intergenic
951937293 3:28035715-28035737 TTCTGCAAGTTATAGATTGATGG - Intergenic
955163214 3:56485537-56485559 TTCTGTAATTAATAGATTGGGGG + Intergenic
955657093 3:61255970-61255992 TTCCGTGTTTTATATATTGAGGG + Intergenic
955881002 3:63545535-63545557 TTCTGTATGTTAGGTAGTGAAGG - Intronic
957013259 3:75032245-75032267 TTCTGTTAGTTAATGATTGAGGG + Intergenic
957467828 3:80618227-80618249 CTCTGCAACTTATATTTTGAGGG + Intergenic
957799220 3:85053144-85053166 TTATTTAACTTATATAATGAAGG + Intronic
958082468 3:88764091-88764113 TTCAATAAACTATATATTGAAGG - Intergenic
959077617 3:101765895-101765917 TTCTCTTATTTATATATTTAAGG - Exonic
959544666 3:107579968-107579990 TTATATAAATTATATATTTATGG + Intronic
960545461 3:118909297-118909319 TTCTGTAGGCTATATAATAATGG + Intronic
961332703 3:126152347-126152369 TTGTGCAAGTGATTTATTGAGGG - Intronic
961861934 3:129923864-129923886 TTCTTAAAGTTATATTTTTAGGG + Intergenic
964182076 3:153900603-153900625 TTCTGGAAGTTATTTATTTATGG + Intergenic
964498016 3:157315325-157315347 TTATGTAATTTATCTATTGCTGG - Intronic
965117011 3:164502896-164502918 CTCAATAAATTATATATTGATGG - Intergenic
965924518 3:173960882-173960904 ATCTGTAAAGTATATATTAAAGG - Intronic
966091495 3:176143926-176143948 TTATGAAAGTTCCATATTGACGG - Intergenic
967342059 3:188409312-188409334 GTCTTTAACTTATATATTAAAGG - Intronic
968257131 3:197286082-197286104 TTCAGTTAGTAATATATTTACGG - Intronic
968424304 4:511565-511587 TTCTGTATGTTATAAACTGATGG + Intronic
968786935 4:2629191-2629213 TTCTGTATTTTATAAATTTAAGG - Intronic
970126616 4:12820241-12820263 TACAGTAAGTTATATAGTGCTGG - Intergenic
970820804 4:20210298-20210320 TTCTATAAATAATGTATTGAAGG - Intergenic
971359606 4:25924597-25924619 ATCTGTATGTTATATATAGGGGG - Intronic
971596360 4:28534351-28534373 TTCTGTGACTTATACATTGTTGG - Intergenic
971843346 4:31885044-31885066 TTTTGTAAGTTTTATAATGAGGG - Intergenic
971935021 4:33136743-33136765 TCTTGTAACTTAGATATTGAGGG - Intergenic
971962712 4:33509426-33509448 TTCTTTGAGTTATATTTTAATGG + Intergenic
972053992 4:34776883-34776905 TTCTGGAAGTTAGAAATTGATGG + Intergenic
973560716 4:52132516-52132538 TTCTGTAAATCAAATATGGAAGG - Intergenic
974863353 4:67550502-67550524 TGCTGTCAGTTATAAATTTATGG + Intergenic
975881056 4:78908469-78908491 TTCTGAATGTTTTATACTGAGGG + Intronic
976983799 4:91266973-91266995 TTGAGTAAGTTTTATATTGAAGG - Intronic
977438229 4:97028437-97028459 TTCTTTAATTTATCTTTTGAGGG + Intergenic
977539033 4:98292462-98292484 TTATGTAAGTGATAGGTTGATGG + Intronic
977750286 4:100601811-100601833 TTCTGGAAGGAATATAATGATGG + Intronic
978042119 4:104079961-104079983 TGCTAGAAGTTATATATTGTAGG - Intergenic
978638134 4:110835851-110835873 AACTGAAATTTATATATTGAAGG - Intergenic
978648026 4:110964652-110964674 TTCAATAAGTTAAATACTGATGG + Intergenic
979029090 4:115617457-115617479 TTCTGTAAGTTTTAAATTTTAGG + Intergenic
979236624 4:118407643-118407665 CTCAGTAAGTTAGGTATTGAAGG + Intergenic
979529974 4:121759832-121759854 TCCTGTCAGTTATATTTTGGTGG - Exonic
979544368 4:121922805-121922827 TTTTGTTATTAATATATTGAGGG - Intronic
979863290 4:125721727-125721749 TTCTGTAGTTCATATATTTATGG - Intergenic
980098294 4:128516233-128516255 TTCTATAAGTGAAATTTTGATGG + Intergenic
980333789 4:131442172-131442194 TTTTGTAAGTTAGATATATATGG + Intergenic
980570853 4:134618148-134618170 TTTTGTAAATTTTATATTAACGG + Intergenic
980587293 4:134833617-134833639 TTCAATAAATTAGATATTGATGG + Intergenic
981848385 4:149197063-149197085 TTCTAGAATTTATATATTTATGG - Intergenic
983535039 4:168848321-168848343 TTGTGTAATTTAGAGATTGAAGG + Intronic
983964181 4:173789860-173789882 CTCAGTAAGTTAGGTATTGATGG + Intergenic
984576595 4:181455719-181455741 TTCTTTAATATATATATTAATGG + Intergenic
984797271 4:183673895-183673917 CTATGTAAGTTATAGAATGATGG + Intronic
985329398 4:188812658-188812680 GTCTTTAAGTTATATTTTTAAGG + Intergenic
985931431 5:3060564-3060586 TTGTGTCCTTTATATATTGAGGG - Intergenic
985966325 5:3341256-3341278 TTCTGTGATTTATACATTGTAGG - Intergenic
987677842 5:21098131-21098153 TTCTGTAAGTAATCCATTAAAGG - Intergenic
987995265 5:25268843-25268865 CTCAGTAAATTAGATATTGAAGG - Intergenic
988018295 5:25589950-25589972 TTTTGTAAGCAATGTATTGAGGG + Intergenic
988385270 5:30555278-30555300 TTCTGTTACATATATATTCAAGG - Intergenic
989773325 5:45171374-45171396 ATTTATAAGTTATATATTAATGG + Intergenic
989826778 5:45866021-45866043 GTATGAAAGTTATATAATGATGG + Intergenic
990553388 5:56906804-56906826 TTTGGTAAGTTATATTTTTATGG - Intergenic
991240807 5:64458133-64458155 ATTTGTAAGTTTTAAATTGAGGG - Intergenic
991538508 5:67700362-67700384 TTCTGTAAGTATCATAGTGATGG + Intergenic
992636868 5:78733216-78733238 TTCAGTAATTTATATAATAAAGG + Intronic
993651093 5:90523090-90523112 TTCTGTAATTTATTTATCAATGG + Intronic
993855457 5:93068703-93068725 TTCTATAAGTTATAGATTTCAGG - Intergenic
993984156 5:94576836-94576858 CTCTGTAACTTACATATTTAAGG - Intronic
994786778 5:104175864-104175886 TTCTGTATTTTATACATTGTAGG - Intergenic
995101285 5:108310030-108310052 TTCTATAAGTTAAATATTTAAGG + Intronic
995209367 5:109519804-109519826 TACTATATGTTATATATTTATGG - Intergenic
996454758 5:123668031-123668053 TTCAGTAAGCTAGGTATTGAAGG + Intergenic
996496188 5:124159666-124159688 TTCTGTGCATTATATATTTAGGG - Intergenic
996549873 5:124719004-124719026 TTCTCTTAGTTACATATTGGTGG - Intronic
996560126 5:124819653-124819675 TTCTGAAAATTATATTTAGAGGG + Intergenic
996816612 5:127581303-127581325 TTCTGTACATTATATATAAATGG - Intergenic
996866403 5:128128098-128128120 TTATGTAATTTAAATATTTAGGG + Intronic
996984477 5:129542544-129542566 TTTTGTATCTTGTATATTGAAGG + Intronic
998200710 5:140116516-140116538 TTCTATAACTCATATATTCAAGG + Exonic
998640805 5:144008702-144008724 TTCTTTGAGTTATATTTTTATGG - Intergenic
998929023 5:147159816-147159838 TTCACAAAGTTAAATATTGAAGG - Intergenic
999046932 5:148479454-148479476 TTATATAAATTATATATTCAAGG - Intronic
999543459 5:152600071-152600093 TTATGTAAGTGATATATTTATGG - Intergenic
1002464073 5:179395961-179395983 TTCTGTAAATTTTATATAAATGG - Intergenic
1002980388 6:2130249-2130271 TTCTGTGTTTTAAATATTGATGG - Intronic
1004568048 6:16817835-16817857 CTATGTAAGATATATATTTATGG + Intergenic
1004771732 6:18790968-18790990 TTCTGTAGGTTGTCTGTTGATGG + Intergenic
1005436975 6:25823018-25823040 TTCTAGAAGTTTTATATTAAGGG + Intronic
1006054734 6:31375320-31375342 ATCAGTAATCTATATATTGATGG + Intergenic
1008064552 6:47033348-47033370 TTCTTTCAGTTATATACTTACGG + Intronic
1008180845 6:48326564-48326586 TTATATAACTTATATAATGAAGG - Intergenic
1010950582 6:82032575-82032597 TTCTGTATGTTAAATCTTCATGG - Intergenic
1012583501 6:100896076-100896098 TTCTTTAGGTTATATTTTGGTGG + Intergenic
1012718757 6:102712961-102712983 GTCTTTAAATTAAATATTGATGG - Intergenic
1014113185 6:117644285-117644307 TTCTGTAAATTATTGATTAATGG + Intergenic
1014393777 6:120898239-120898261 TTCTGAAAGATATAAAGTGAAGG + Intergenic
1014634722 6:123830995-123831017 TTTTGTAAGTTGCATATTTAAGG + Intronic
1015027038 6:128547316-128547338 TTCTATAAGTTATTGATAGAGGG - Intergenic
1015365174 6:132389202-132389224 TTCTCTAATTTATATAGTGAGGG - Intronic
1015596101 6:134868705-134868727 CTCTGCAAGTTATATTGTGAAGG + Intergenic
1015617610 6:135093836-135093858 CTTTGTAAGTGATATATTGAAGG + Intronic
1016337220 6:143020220-143020242 TTATGTAAATAATATATTGTTGG + Intergenic
1017185984 6:151600959-151600981 TTCTGTAAATTGTATATAAATGG + Intronic
1018262805 6:161987351-161987373 TTATGTAAAATATATATCGATGG + Intronic
1018373485 6:163189559-163189581 ATCTGTAAGCTAAAAATTGATGG - Intronic
1018585884 6:165358269-165358291 TTCTGTAAGTTACTTAAGGAGGG + Intronic
1021028976 7:15705700-15705722 TTCTGTAATTCATAAATTGAGGG + Intergenic
1021355323 7:19647933-19647955 TTCTGTAATATATATATCTAAGG + Intergenic
1024402913 7:48945867-48945889 TTTTGTCTGTTATATATTCAGGG + Intergenic
1025721741 7:64022197-64022219 TTCTGAAAGTAACATGTTGAAGG - Intergenic
1027639976 7:80720939-80720961 TTTTGTAAGTTATAAATGTATGG - Intergenic
1027796346 7:82698494-82698516 TTCTTTAAATTATCTATGGATGG - Intergenic
1027948974 7:84788333-84788355 TTTTATAATTTATATTTTGAAGG - Intergenic
1028040433 7:86045671-86045693 TTCTGTATGTGATATAAGGAAGG - Intergenic
1028047420 7:86140216-86140238 TTATTTAAGTTATATATTACAGG - Intergenic
1028866466 7:95719501-95719523 TTCAGTAAGATATATATTTCAGG + Intergenic
1030798200 7:113815852-113815874 TTCTGTAGGTGTTTTATTGAAGG + Intergenic
1031050500 7:116940003-116940025 TTCTGTAAGTTAGATTTTGCAGG - Intergenic
1031278324 7:119761407-119761429 CTTTGTAATTGATATATTGAAGG + Intergenic
1031298031 7:120028666-120028688 TTCTATAAGCTAGGTATTGAAGG - Intergenic
1031311631 7:120206401-120206423 TTCTGTTACATATATATTAATGG - Intergenic
1031744677 7:125479335-125479357 TTTTGGAAGTGATATATTTATGG + Intergenic
1031834876 7:126670347-126670369 TTCTTTAGGTTATATCTTGGTGG + Intronic
1033387471 7:140892418-140892440 TTCTGTATTTTACATATTAAGGG - Intronic
1035717606 8:1765519-1765541 TTTTGAAAATTATACATTGATGG - Intronic
1037000519 8:13712720-13712742 TTATTTAAGTTATATAATGGAGG - Intergenic
1037532086 8:19787366-19787388 TTCTGTGATTTATATATTATTGG - Intergenic
1037634032 8:20684336-20684358 CTCAATAAATTATATATTGATGG - Intergenic
1038126298 8:24676605-24676627 TACTTTACGTTATTTATTGATGG + Intergenic
1041701341 8:60792422-60792444 TTCTTTGATTTGTATATTGATGG + Intronic
1042757680 8:72235014-72235036 TTCTGAAATTTATATATAAAAGG - Intergenic
1042993083 8:74662603-74662625 TTCTGTAAGGTATAATTTGAGGG + Intronic
1043169923 8:76953241-76953263 TTCTGTAATTTATCTACTGAGGG + Intergenic
1045845355 8:106628587-106628609 TACTGTAAGTTTTATAGTAATGG - Intronic
1046841567 8:118864127-118864149 TTCTGTAAATTATAATTTGTAGG + Intergenic
1047664175 8:127072239-127072261 ATCTGTAAGTTTTACACTGAGGG - Intergenic
1051135031 9:13910524-13910546 TTCTGTAAGGAATATTATGACGG + Intergenic
1052116543 9:24655425-24655447 ATTTGTAAGTTATATATTCTTGG + Intergenic
1053671068 9:40362548-40362570 TTCTGTTTCTTATATATTGCTGG + Intergenic
1053920877 9:42988910-42988932 TTCTGTTTCTTATATATTGCTGG + Intergenic
1054382185 9:64502608-64502630 TTCTGTTTCTTATATATTGCTGG + Intergenic
1054513545 9:66013751-66013773 TTCTGTTTCTTATATATTGCTGG - Intergenic
1055201284 9:73665516-73665538 TTCTGTAGCTTATAGATAGATGG + Intergenic
1055418757 9:76113410-76113432 TTATGTAAGATTTATATAGACGG - Intronic
1055546785 9:77384097-77384119 TTATGTAAGTGATATAATGAAGG + Intronic
1058232272 9:102441745-102441767 ATCTGTGAGTTACGTATTGATGG + Intergenic
1059478084 9:114564951-114564973 TTCTCTAAGTTATATTTATATGG - Intergenic
1060288270 9:122274643-122274665 TTTAGTAAGTTATATATTTTAGG + Intronic
1060332050 9:122681859-122681881 TTTTGTATTGTATATATTGAAGG + Intergenic
1061522561 9:131128163-131128185 TTCTTAAAGATATATAATGATGG - Intronic
1061530176 9:131205478-131205500 TTCTGTTGGTTACATATTCAGGG - Intronic
1062301421 9:135873992-135874014 TTATTTATTTTATATATTGACGG - Intronic
1185800824 X:3009082-3009104 TACCGTAAGATATATATTAATGG + Intronic
1185913742 X:4011163-4011185 TTCTGAATGTAATATTTTGATGG + Intergenic
1187611985 X:20953293-20953315 TTCTGTCAGTCATTGATTGAGGG + Intergenic
1187775312 X:22750015-22750037 TTTTGTAAGTTATTTCCTGAGGG + Intergenic
1188088040 X:25926546-25926568 TTCTGTAAGTTTTATAATTTGGG + Intergenic
1188254663 X:27946753-27946775 TACTGTAAGAAATATTTTGAGGG + Intergenic
1188276307 X:28205883-28205905 TTGAATAAGTTATTTATTGAAGG + Intergenic
1188489209 X:30719741-30719763 GTCTGTAAGTTGTATAGTGAAGG + Intronic
1188914531 X:35893390-35893412 TTCTGAAAATTATATATTTAAGG + Intergenic
1188943251 X:36265579-36265601 TTCGGTAAGTAATTTGTTGAGGG + Intronic
1193223999 X:78960257-78960279 TTCTCTAAGTTGTATTTTGCAGG - Intronic
1194696004 X:97051915-97051937 TTCAGTAAATACTATATTGAAGG - Intronic
1194894525 X:99423942-99423964 TTCTGTAATTTATTCACTGAAGG + Intergenic
1195113075 X:101666613-101666635 TTCTGAAATGTATACATTGAAGG - Intergenic
1195524303 X:105868747-105868769 AACTGTAAGGGATATATTGAGGG + Intronic
1195831938 X:109068809-109068831 CTCAATAAGTTAGATATTGATGG - Intergenic
1196270697 X:113707050-113707072 TTCTGGAAGTGATATATTACTGG + Intergenic
1196562139 X:117162607-117162629 TTCTGTAAGGAATAGATTCAAGG + Intergenic
1196675028 X:118410821-118410843 TTCTGGATGTTATATTTTGGTGG + Intronic
1197561003 X:128022098-128022120 TTCTATAATTAATATGTTGAGGG - Intergenic
1197895651 X:131311538-131311560 TTTGGTAAGTTCTATTTTGAGGG - Intronic
1199231445 X:145440956-145440978 TTCAGTAATTTATAAACTGATGG - Intergenic
1200324171 X:155220815-155220837 TTCTGTAAGATAAATATTTATGG + Intronic
1200846066 Y:7833252-7833274 TTCTGTAGCTTTTAGATTGAGGG - Intergenic
1201262201 Y:12170483-12170505 CTCAGTAAATTAGATATTGATGG - Intergenic