ID: 947013444

View in Genome Browser
Species Human (GRCh38)
Location 2:225591110-225591132
Sequence AGCATGGCGGGCCCTCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947013431_947013444 21 Left 947013431 2:225591066-225591088 CCATCCAGATGAGTCCAGGCTTT 0: 1
1: 0
2: 1
3: 14
4: 156
Right 947013444 2:225591110-225591132 AGCATGGCGGGCCCTCCAGATGG 0: 1
1: 0
2: 0
3: 3
4: 88
947013433_947013444 17 Left 947013433 2:225591070-225591092 CCAGATGAGTCCAGGCTTTTGGA 0: 1
1: 0
2: 0
3: 16
4: 150
Right 947013444 2:225591110-225591132 AGCATGGCGGGCCCTCCAGATGG 0: 1
1: 0
2: 0
3: 3
4: 88
947013439_947013444 7 Left 947013439 2:225591080-225591102 CCAGGCTTTTGGAGGGGGAGGAC 0: 1
1: 0
2: 0
3: 18
4: 167
Right 947013444 2:225591110-225591132 AGCATGGCGGGCCCTCCAGATGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947013444 Original CRISPR AGCATGGCGGGCCCTCCAGA TGG Intronic
901294192 1:8147819-8147841 AAAATGGCAGGCTCTCCAGATGG - Intergenic
908582028 1:65525953-65525975 AGCTTAGCGGGACCACCAGAGGG + Intronic
911618220 1:100038098-100038120 GGCAGGCCGGGCCCTCAAGATGG + Exonic
912505280 1:110151516-110151538 AGGACGGCGCCCCCTCCAGATGG - Intronic
916557724 1:165907723-165907745 TGAATGGAGGGCCCTCCAAACGG + Exonic
919241144 1:194917969-194917991 AGCATGACCGGCCATCCAGGGGG + Intergenic
921063987 1:211609798-211609820 AGCATGTGGGGGCCACCAGAAGG - Intergenic
1062799544 10:368971-368993 GGCACGGCGGGCCCTGCAGCTGG + Intronic
1064249189 10:13693842-13693864 AGCATGGCTGGGACCCCAGAGGG - Intronic
1067041056 10:42953475-42953497 AGCATGGAGGGCCCTTCCCAGGG - Intergenic
1067539843 10:47143552-47143574 AGCATGAAGGGCTCTCCAGGTGG + Intergenic
1072619657 10:97071333-97071355 AGGAAGGCGGGACCTCCAGTGGG + Intronic
1075712493 10:124538073-124538095 CGCATGGCGGGCCCCGCAGGTGG - Intronic
1075997676 10:126891723-126891745 AGCATGGCGGGGCCGGCAGCAGG - Intergenic
1076717480 10:132373766-132373788 AGCCTGGCGGGGTCTCCACAGGG + Intronic
1077444735 11:2585710-2585732 GGGATGCCAGGCCCTCCAGAAGG - Intronic
1077922092 11:6649265-6649287 AGCATCCCGAGCCCTCCAGCAGG - Intronic
1082847772 11:57740411-57740433 AGCATGGCAGGCCTTCCTGTAGG - Exonic
1083256124 11:61496454-61496476 GGAATGGGTGGCCCTCCAGATGG - Intergenic
1083627287 11:64078218-64078240 AGTAGGACGTGCCCTCCAGAAGG + Intronic
1085340298 11:75727023-75727045 AGCATGGCGGTGCCTCCATGTGG + Intronic
1090606717 11:128429292-128429314 AGAATGGCAGGCCCTGCACAGGG + Intergenic
1091128482 11:133123590-133123612 AGCATGCCGGGCTGACCAGATGG - Intronic
1098369035 12:69738521-69738543 AGCATGTTGGGCTCTCCAGGAGG - Intergenic
1103328671 12:120138581-120138603 CGCAATGTGGGCCCTCCAGAGGG - Intronic
1107960785 13:45556102-45556124 AGCAGAGGGGGCCCTCCAGCTGG - Intronic
1113891210 13:113736548-113736570 AGCACCGCCGGCCCTCAAGAGGG - Exonic
1114637388 14:24195575-24195597 AGCTGGGCCGGGCCTCCAGATGG - Intronic
1122287102 14:100658584-100658606 AGCATTGGGGGAGCTCCAGAAGG + Intergenic
1125759840 15:42088867-42088889 AGCATGGCAGGACCCCCAGGAGG + Intronic
1134811829 16:17174107-17174129 TCCCTGGCTGGCCCTCCAGAGGG + Intronic
1141343943 16:83228239-83228261 AGCATGCCTGACCCACCAGATGG - Intronic
1142262165 16:89048128-89048150 AGCAGCGCCGGCCCTCCAGGCGG - Intergenic
1144492835 17:15729542-15729564 AGCATGGAGGGCCATTCAGTAGG - Intergenic
1147382398 17:40063350-40063372 GGCCGGGCGGGCCCTCCAGGGGG - Intronic
1152214371 17:79024028-79024050 AGCCTGGCGGGCTCCCCAGGGGG + Intronic
1152228660 17:79104017-79104039 AGCCTGGCGGGACCTACAGCCGG + Intronic
1160411017 18:78675500-78675522 AGCTTGGCTGGGCCTCCAGGCGG - Intergenic
1160732286 19:646739-646761 CGCGTGGCGGGCCCTCCTGGTGG - Intergenic
1160893037 19:1389433-1389455 AGCAGGGCGGACCCTCCCGGAGG + Intronic
1161824354 19:6552148-6552170 AGCAGGGCGTGGGCTCCAGAGGG + Intergenic
1161948445 19:7453666-7453688 AGCATAGCATGCCCTCCAGGTGG - Exonic
1163700545 19:18784607-18784629 AGGATGGGGGGCTCTGCAGAAGG + Intronic
1164620739 19:29694752-29694774 TGCCTGGCTGGCCCACCAGAGGG + Intergenic
1165923015 19:39310485-39310507 AGCAGGAATGGCCCTCCAGAGGG - Intronic
926155948 2:10454155-10454177 AGCCTTGCGGGCCCTCCAAGGGG + Intergenic
928545150 2:32322514-32322536 AGAATGGCGTGAACTCCAGAGGG + Intergenic
935243058 2:101194600-101194622 AGCCTGGTGGGCCCTCCATGAGG - Intronic
939872594 2:147541754-147541776 AGCATGGTGGGCCAGGCAGAAGG - Intergenic
943738674 2:191387291-191387313 GGCATGGCTGGCCTTCCACATGG - Exonic
945821663 2:214672866-214672888 AGCATGGGTTGGCCTCCAGAAGG - Intergenic
947013444 2:225591110-225591132 AGCATGGCGGGCCCTCCAGATGG + Intronic
1174776302 20:53345925-53345947 AGCATGCCGGTCACTCAAGAGGG + Intronic
1174794684 20:53512157-53512179 TGCAGTGAGGGCCCTCCAGAGGG - Intergenic
1175234654 20:57501684-57501706 AGGATGGCGGGAACTCCAGCTGG + Intronic
1175741839 20:61425234-61425256 AGCAGGGCGGGCACCACAGAAGG + Intronic
1176137242 20:63529646-63529668 CGCTGGGCGGGCACTCCAGAGGG + Exonic
1179822573 21:43945116-43945138 AGCATGGGTGGCCCTGCAGGTGG + Intronic
1179889152 21:44327049-44327071 AGCCTGCCAGGCCCTCCAGCAGG + Exonic
1179970548 21:44834851-44834873 GTCCTGGCGAGCCCTCCAGAGGG + Intergenic
1181104795 22:20567797-20567819 TGCATGGAGGGGCCTCCAGAAGG - Intronic
1181534112 22:23532992-23533014 ATCAGGGTGGGCCCTGCAGAAGG + Intergenic
1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
950072695 3:10165104-10165126 AGCTTGGCGGCCGCTCCAGGCGG - Intronic
950864119 3:16175388-16175410 AGGGTGGCAGGCCCTCCAGAGGG - Exonic
961346872 3:126268658-126268680 AGCAGGGCAGCCCCTGCAGAGGG + Intergenic
961677454 3:128576325-128576347 AGCATGGTGTGCACTCCACAGGG - Intergenic
964869272 3:161295416-161295438 GGCATTGAGTGCCCTCCAGATGG + Intergenic
971224192 4:24736129-24736151 AGCATGGAGGGCTCTCTGGATGG + Intergenic
976221935 4:82762976-82762998 GGCATGGAGAGCCCTACAGAGGG - Intronic
986130847 5:4928638-4928660 AGCATGGCGTGCTCTGCAGCAGG - Intergenic
992411618 5:76510827-76510849 AGCAGGCTGGGCCTTCCAGAAGG + Intronic
997611313 5:135217774-135217796 ACCCTGGCTGGCCCTCCAGGGGG - Intronic
1002050125 5:176565807-176565829 GGCATGGTGGGGGCTCCAGAGGG - Intronic
1003578023 6:7315292-7315314 GGCTTGGCGGGCCCTGCAGTGGG + Intronic
1006272118 6:32972686-32972708 AGCTTGGCGCGCTCTGCAGACGG - Exonic
1013485320 6:110590855-110590877 AGCATTGCAGTGCCTCCAGAAGG + Intergenic
1019591963 7:1840027-1840049 AGCACGGCGGGCATTCCACATGG + Intronic
1026878737 7:73894795-73894817 GGGCTGGGGGGCCCTCCAGAGGG - Intergenic
1028776969 7:94688302-94688324 ACTTTGGCGGGCCCTCCAGAAGG - Intergenic
1037501717 8:19492648-19492670 AGCATGGCTGGGCTTCCAGCTGG - Intronic
1037837376 8:22222053-22222075 AGCAGGGAGGGCCCTGGAGAGGG + Intronic
1042336780 8:67638346-67638368 ACCATGGCTAGCCCTCCAGCAGG + Intronic
1049181027 8:141222286-141222308 ACCATGGAGGGTCCTGCAGAGGG + Intronic
1053407077 9:37886556-37886578 AGCATGGCAGGCCTTCCTGTAGG - Intronic
1057105419 9:92410505-92410527 ACCCTGGTGGGCCATCCAGATGG + Intronic
1061063069 9:128260432-128260454 AGGAGGGCGGGCTCTCCAGGTGG + Intronic
1062422467 9:136489712-136489734 AGCCTGGCGGCCCCTTCAGCAGG - Intergenic
1186857298 X:13638457-13638479 AGAATGGGGGGCCCTGGAGAGGG + Intergenic
1190266349 X:48829411-48829433 AGCAGGGCAGGCCATCCATAGGG + Exonic
1197837567 X:130711855-130711877 AGCCAGGCCAGCCCTCCAGATGG + Intronic