ID: 947014712

View in Genome Browser
Species Human (GRCh38)
Location 2:225606265-225606287
Sequence ACCTCTGGACACTTTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 1, 2: 6, 3: 66, 4: 432}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947014712_947014715 -4 Left 947014712 2:225606265-225606287 CCCAGATCAAAGTGTCCAGAGGT 0: 1
1: 1
2: 6
3: 66
4: 432
Right 947014715 2:225606284-225606306 AGGTGTGAACTTTCTGCACTTGG 0: 1
1: 0
2: 1
3: 9
4: 128
947014712_947014716 11 Left 947014712 2:225606265-225606287 CCCAGATCAAAGTGTCCAGAGGT 0: 1
1: 1
2: 6
3: 66
4: 432
Right 947014716 2:225606299-225606321 GCACTTGGTTTCCAAATTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947014712 Original CRISPR ACCTCTGGACACTTTGATCT GGG (reversed) Intronic
900086507 1:900483-900505 ACCTCTGCACACTTGACTCTGGG + Intergenic
900381724 1:2387499-2387521 TTCTCTGGACAGTTTGTTCTGGG - Exonic
902673993 1:17995696-17995718 CGCCTTGGACACTTTGATCTTGG - Intergenic
902803658 1:18847299-18847321 CCCTGCTGACACTTTGATCTTGG + Intronic
903577090 1:24345680-24345702 ACCCCTTGACACTTTGGCCTAGG + Intronic
905077386 1:35284686-35284708 ACCTGTGGGCACTTTGATCTTGG - Intronic
905267603 1:36765465-36765487 ACCTCTGGAGCTTTTGATTTAGG + Intergenic
906803445 1:48757433-48757455 ACCTCTGTAGACTATGATTTGGG + Intronic
907626905 1:56039506-56039528 ACCTGCTGACACCTTGATCTTGG - Intergenic
907698954 1:56764826-56764848 ATCTGTTGTCACTTTGATCTTGG - Intronic
908032411 1:60015531-60015553 ACCTACTGACACCTTGATCTTGG - Intronic
908254021 1:62287661-62287683 ACCCCAGGACACTCTGCTCTTGG - Intronic
908711857 1:67024545-67024567 TCCTGTAGACACTTTCATCTTGG - Intronic
908846320 1:68328231-68328253 CCCTACTGACACTTTGATCTTGG - Intergenic
909112091 1:71492090-71492112 ACCTACTGGCACTTTGATCTTGG + Intronic
909302200 1:74027559-74027581 ACCTGCTGACACTTTGTTCTTGG + Intronic
909325483 1:74346781-74346803 ACCTGTTGACACCTTGATCTTGG - Intronic
910458322 1:87422013-87422035 ACCTGCAGACACCTTGATCTTGG - Intergenic
911303379 1:96203849-96203871 ACCTGTTGACAATTTGATATTGG - Intergenic
911507658 1:98773691-98773713 ACCTGCTGACACCTTGATCTTGG - Intergenic
911535417 1:99094097-99094119 ACCTGCTGACACCTTGATCTTGG + Intergenic
911753404 1:101524862-101524884 TCCTATGGACACTTTGATTTTGG - Intergenic
912405099 1:109431035-109431057 ACCTTCTGACACGTTGATCTTGG + Intergenic
913041113 1:115024894-115024916 TCCTGCAGACACTTTGATCTTGG - Intergenic
913649214 1:120894515-120894537 ATCTGTTGACACCTTGATCTTGG + Intergenic
914172391 1:145237532-145237554 ATCTGTTGACACCTTGATCTTGG - Intergenic
914297269 1:146339998-146340020 ATCTGTTGACACCTTGATCTTGG - Intergenic
914315617 1:146508798-146508820 ACCTGCAGACACCTTGATCTTGG - Intergenic
914498738 1:148224563-148224585 ACCTGCAGACACCTTGATCTTGG + Intergenic
914527036 1:148478535-148478557 ATCTGTTGACACCTTGATCTTGG - Intergenic
914639362 1:149588600-149588622 ATCTGTTGACACCTTGATCTTGG + Intergenic
916821562 1:168403874-168403896 ATCTGCTGACACTTTGATCTTGG - Intergenic
916992831 1:170263355-170263377 ACCTGTCAACTCTTTGATCTAGG - Intergenic
917173868 1:172209288-172209310 ACCTGCTGACACCTTGATCTTGG + Intronic
917206733 1:172582086-172582108 ACCTCTGCCTACTTTGATATTGG + Intronic
917869880 1:179231669-179231691 ACTTATGGACTATTTGATCTGGG + Intergenic
918272628 1:182917581-182917603 ATCTGTTGACACATTGATCTTGG - Intronic
918790890 1:188826527-188826549 ACCTATTGGCACTTTGATCTTGG + Intergenic
919005700 1:191896926-191896948 ATCTGTTGACACCTTGATCTTGG - Intergenic
921074420 1:211688044-211688066 ATTTCTGGACACTCTGATTTTGG + Intergenic
922016711 1:221655591-221655613 ACCGCTAGACACTTTGATTTAGG - Intergenic
922078273 1:222269154-222269176 TCCTGCCGACACTTTGATCTTGG - Intergenic
922132565 1:222794690-222794712 ACCTGCCAACACTTTGATCTTGG + Intergenic
922173485 1:223176977-223176999 ACCTGTTGGCACCTTGATCTTGG + Intergenic
922200285 1:223394828-223394850 ACCGCTGGAAACTTTGTTCCAGG - Exonic
922755737 1:228095950-228095972 TCCTTTGGACACTTTGCTCTTGG - Intronic
1062957691 10:1551230-1551252 GCCCCTGGACACCTTGATCTCGG + Intronic
1063388236 10:5630489-5630511 ACCTGCTGACAGTTTGATCTTGG + Intergenic
1064491772 10:15865410-15865432 ACCTCTCAACACCTTGATTTTGG + Intergenic
1064837072 10:19545047-19545069 ACCTGCTGACACCTTGATCTTGG - Intronic
1066346226 10:34589507-34589529 ATCTGCCGACACTTTGATCTTGG + Intronic
1066353955 10:34664115-34664137 ACCTCTGGTCTCTTTGGTCTCGG - Intronic
1067788239 10:49268315-49268337 CTCTGTGGACACCTTGATCTTGG - Intergenic
1068939468 10:62666617-62666639 TCCTGTGGACACCTTGATCTTGG + Intronic
1069358500 10:67614814-67614836 ACCTGTTGACACCTTGGTCTTGG - Intronic
1069515189 10:69071807-69071829 AACTCTGGACACTTTTGTCAGGG - Intergenic
1070403626 10:76075419-76075441 CCCTGTGGGCACCTTGATCTTGG + Intronic
1072019437 10:91383598-91383620 AGCTCTGGAGAATTTGATATGGG + Intergenic
1072099293 10:92214359-92214381 CCCACTGGCAACTTTGATCTTGG + Intronic
1072207508 10:93217346-93217368 AACTGCTGACACTTTGATCTTGG - Intergenic
1072745216 10:97934848-97934870 ACCTAGGGACACTGTGACCTGGG + Intronic
1073545986 10:104349331-104349353 ACCTGCTGACACTTTGATCTTGG - Intergenic
1074275499 10:111997723-111997745 ACCTGTCAACACTTTCATCTTGG + Intergenic
1074326917 10:112459448-112459470 TCCTCTGGCCACATTCATCTGGG - Intronic
1076225821 10:128774360-128774382 ACCTCTGGTGTCTTTGACCTTGG - Intergenic
1076381221 10:130025610-130025632 ACCTATTGGCACCTTGATCTTGG + Intergenic
1078581054 11:12540026-12540048 ACCCCTGAAAACTTTGATTTAGG + Intergenic
1079345118 11:19645107-19645129 ACCTTTCGACACCTTGATTTCGG - Intronic
1080014687 11:27491971-27491993 GTCTCCTGACACTTTGATCTTGG - Intergenic
1080602029 11:33829550-33829572 AGCTCTGGACCCTATGATCTCGG + Intergenic
1080855170 11:36105757-36105779 CCCTGCGGACATTTTGATCTTGG + Intronic
1081142016 11:39513186-39513208 ATCTCCTGTCACTTTGATCTTGG - Intergenic
1081440254 11:43072992-43073014 ATCTGCTGACACTTTGATCTTGG - Intergenic
1082643504 11:55692820-55692842 ACCAAGGGACACCTTGATCTTGG - Intergenic
1084343953 11:68530749-68530771 ATCTCTGAACATTTTGCTCTGGG + Intronic
1086738667 11:90339940-90339962 ACCTGCTGACACCTTGATCTTGG - Intergenic
1087356798 11:97103764-97103786 ACCTCCTGACACCTTGATCTTGG + Intergenic
1087358322 11:97123523-97123545 ATCTGTGGACACTTTGACATTGG + Intergenic
1087462634 11:98464014-98464036 ACCTCTGAACACTATCATATTGG - Intergenic
1087481467 11:98706507-98706529 ACCTTCTGACACCTTGATCTTGG + Intergenic
1088784859 11:113172071-113172093 CCCTGGGGACACTTTGATCTTGG + Intronic
1088816965 11:113428042-113428064 CCCTGTTGACACCTTGATCTGGG + Intronic
1090245043 11:125210166-125210188 CCCTCTGAATCCTTTGATCTGGG + Intronic
1090543090 11:127730567-127730589 ACCTGTAAACACCTTGATCTTGG - Intergenic
1090574910 11:128090274-128090296 ACCTACTAACACTTTGATCTTGG - Intergenic
1091318277 11:134631588-134631610 GCCTCCTGACACCTTGATCTTGG - Intergenic
1091497259 12:983372-983394 ACCTGCTGACACCTTGATCTTGG - Intronic
1092634463 12:10426824-10426846 ACCTGCTGGCACTTTGATCTTGG - Intronic
1092635506 12:10442247-10442269 ACCTGCTGGCACTTTGATCTGGG - Intronic
1093129797 12:15376643-15376665 ACCTGTTGGCACCTTGATCTTGG - Intronic
1093535667 12:20219785-20219807 ACCTGTGGGCACCTTGATCTTGG + Intergenic
1093953721 12:25193450-25193472 ACCTGCTGACACTTTGATCTTGG + Intronic
1094683852 12:32691086-32691108 ACCTGCTGACACTTTGATCTTGG - Intronic
1096148830 12:49296282-49296304 ACCTCTGGATACTGAGATCGGGG - Intronic
1097210439 12:57364509-57364531 ATCTGTGAACACCTTGATCTTGG - Intronic
1098521485 12:71439481-71439503 CCCTCTCGACTCTTAGATCTGGG + Intronic
1098853995 12:75631651-75631673 ACCTGTCAACACCTTGATCTTGG - Intergenic
1099348093 12:81527898-81527920 ATCTGCTGACACTTTGATCTTGG + Intronic
1099577837 12:84403465-84403487 TCTTCTGGACACTTTCAGCTGGG - Intergenic
1100179563 12:92070652-92070674 ACCTCTGCCCACTGTTATCTTGG - Intronic
1100694079 12:97072259-97072281 ACCTGTTGACATCTTGATCTTGG - Intergenic
1100776267 12:97978645-97978667 GCCTCAGGGCTCTTTGATCTTGG + Intergenic
1101702319 12:107185834-107185856 ACCTGCTGACACTTTGATCTTGG + Intergenic
1102231793 12:111267652-111267674 CCCTGTTGACACCTTGATCTTGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103948117 12:124538241-124538263 CCCTCTGGACAATGTGACCTTGG - Intronic
1104519330 12:129458377-129458399 ACCTCTGCCCACTCTGATATAGG - Intronic
1104716884 12:131021588-131021610 ACCTACCGACACCTTGATCTTGG - Intronic
1106115797 13:26816495-26816517 CCCTGTGGACACCTTGATCGTGG - Intergenic
1106661043 13:31799805-31799827 ACCTGCTGACACTTTGATCTTGG - Intronic
1107073519 13:36297502-36297524 ACCCCTGGGCACTTCGGTCTGGG - Intronic
1107338182 13:39378427-39378449 ACTTCTGGCCAGTTTGACCTGGG - Exonic
1107469597 13:40679856-40679878 ACCTGCTGGCACTTTGATCTTGG + Intergenic
1107977137 13:45701126-45701148 GCCTCTGGACACCCTGGTCTAGG + Intergenic
1108064324 13:46562345-46562367 ACCTGCCGACACCTTGATCTTGG - Intronic
1108299356 13:49058641-49058663 ACCTGCTGACACCTTGATCTTGG + Intronic
1108716255 13:53081029-53081051 CCCTCCTGACACCTTGATCTTGG + Intergenic
1108914550 13:55590876-55590898 TCCTCTGGACCCTTTCAGCTGGG + Intergenic
1109173549 13:59126457-59126479 ACCTGTTGACACTTTGTTCTTGG - Intergenic
1109390866 13:61690956-61690978 ATCTGCTGACACTTTGATCTTGG + Intergenic
1109663811 13:65502826-65502848 AGCCCTTGACACTTTGATTTTGG - Intergenic
1109998357 13:70160402-70160424 ATCTGTGGGCACTTTGATCTTGG - Intergenic
1110273942 13:73621811-73621833 AACTCTTGACACCTTGATTTTGG - Intergenic
1110437918 13:75495800-75495822 ATCTCTTGGCACTTTGATCTTGG + Intergenic
1110779138 13:79444095-79444117 CCCTGTGGATACCTTGATCTTGG - Intergenic
1111909918 13:94299664-94299686 ATCTGTTGGCACTTTGATCTTGG + Intronic
1112069025 13:95827513-95827535 CCCTGTGGACACCTTCATCTTGG + Intronic
1113501342 13:110777228-110777250 CCCTACGGACACCTTGATCTGGG + Intergenic
1114531923 14:23401889-23401911 CCAGCTTGACACTTTGATCTGGG + Intronic
1116321727 14:43475850-43475872 ACCTGCTGACACCTTGATCTTGG + Intergenic
1116630118 14:47320105-47320127 CCCTGTGGACACCTTGATCTTGG + Intronic
1117503833 14:56380926-56380948 AGCACTGGAGACTTTGACCTTGG - Intergenic
1117676832 14:58163858-58163880 CCCTGTCGACACCTTGATCTTGG + Intronic
1118073164 14:62268490-62268512 ACCTTCTGACACCTTGATCTTGG - Intergenic
1118580884 14:67296217-67296239 ACCTCTGTACCCTTTGAGCATGG - Intronic
1120157562 14:81110474-81110496 ACTTGCTGACACTTTGATCTTGG + Intronic
1120253401 14:82088497-82088519 ACCTGCTGGCACTTTGATCTTGG - Intergenic
1120841551 14:89089782-89089804 CCCTGTTGACACCTTGATCTTGG + Intergenic
1120918095 14:89727789-89727811 ACCTGCCGACACCTTGATCTCGG + Intergenic
1121697110 14:95922622-95922644 ACCTTGGGACACCTTGCTCTTGG - Intergenic
1121791257 14:96701413-96701435 ACTTCTTGACACTTTGATTGTGG - Intergenic
1121941960 14:98079527-98079549 CCCTGTTGACACTTTGATTTTGG - Intergenic
1122024191 14:98863160-98863182 ACCTGTGGACACCTTGGTTTTGG + Intergenic
1124429229 15:29592029-29592051 CCCTCCTGACACCTTGATCTTGG + Intergenic
1124633736 15:31352195-31352217 TCCCCTGGACACTGAGATCTTGG + Intronic
1124851214 15:33340533-33340555 ACCTGCCGACACCTTGATCTTGG - Intronic
1124861496 15:33446463-33446485 ATCTGTTGACACCTTGATCTCGG - Intronic
1125350182 15:38758462-38758484 AGCTCTGGTCACTTTGAGCCAGG - Intergenic
1126949522 15:53865355-53865377 ACCTGCTGACACCTTGATCTTGG - Intergenic
1127765702 15:62183961-62183983 ACCTCTTGACCCTTTGCCCTTGG + Intergenic
1129062319 15:72869871-72869893 ACCCCTGGACATTTTGATCTGGG + Intergenic
1129079326 15:73025216-73025238 ACCTGCAGACACCTTGATCTTGG + Intergenic
1129330359 15:74823987-74824009 ACCACTGGACTCAGTGATCTTGG - Intronic
1129555773 15:76507321-76507343 ACCTGTTGACACCTTGATCTTGG + Intronic
1129633917 15:77293876-77293898 ACCTCTGGACATTTTGTTTGGGG - Intronic
1129731722 15:77936209-77936231 ACCCCTGCACCCTTTGGTCTTGG - Intergenic
1130873803 15:87994558-87994580 CCCTCCAGACACCTTGATCTTGG + Intronic
1131093480 15:89641307-89641329 ACCTGTAGACACCTTGAGCTCGG + Intronic
1131366647 15:91847160-91847182 ACCTGTCAACACCTTGATCTTGG - Intergenic
1131676667 15:94677113-94677135 CCCTCTGGAAACTTACATCTTGG - Intergenic
1131958357 15:97762389-97762411 AGCTCTGTACTCTCTGATCTTGG - Intergenic
1131994682 15:98122691-98122713 CTCTGTGGACACCTTGATCTTGG - Intergenic
1132629267 16:908957-908979 CCCTCTGGACACCTTGTCCTGGG + Intronic
1133505485 16:6408107-6408129 ATCTGTCGACACCTTGATCTTGG + Intronic
1133556555 16:6911343-6911365 CCCTCCTGACACCTTGATCTTGG - Intronic
1135690621 16:24534384-24534406 ACATCTGGACATTTTGTTGTTGG - Intergenic
1135839688 16:25863928-25863950 ACCTGCCGACACCTTGATCTTGG - Intronic
1136368645 16:29821838-29821860 GCCTCTGGACCCTGTGTTCTAGG - Intronic
1136654498 16:31701876-31701898 ACCTGTAGACACTTTCACCTAGG + Intergenic
1137906079 16:52323275-52323297 AGATCAGGACACTTTCATCTGGG + Intergenic
1138038516 16:53634050-53634072 ACCTGCTGACACCTTGATCTTGG - Intronic
1138088230 16:54153376-54153398 CCCCGTGGACACCTTGATCTTGG + Intergenic
1138209411 16:55150889-55150911 ACCTGCTGACACCTTGATCTTGG - Intergenic
1138640211 16:58379805-58379827 CCCTGTGGACACCTTGATATTGG + Intronic
1139157174 16:64457680-64457702 ACCTGCCAACACTTTGATCTTGG - Intergenic
1139184086 16:64783665-64783687 ACCTACTGACACCTTGATCTTGG + Intergenic
1139528632 16:67530769-67530791 ACCTTTGGAACCTTGGATCTGGG + Intronic
1139818412 16:69697283-69697305 ATCTTTGGCCACTTTAATCTAGG + Exonic
1140544994 16:75799126-75799148 ACCTGCTGACACCTTGATCTTGG - Intergenic
1141870880 16:86784651-86784673 CCCTATGGACACCTTGATTTTGG + Intergenic
1143318460 17:6051345-6051367 CCCTCCTGACACCTTGATCTGGG + Intronic
1143843624 17:9755111-9755133 ACCTGCTGACACCTTGATCTTGG - Intergenic
1143880721 17:10027687-10027709 ACCTGCCGACACCTTGATCTTGG + Intronic
1144640708 17:16935130-16935152 ACCTGTGGACACTCTGATGCTGG - Intronic
1146158963 17:30549005-30549027 CCCTGCTGACACTTTGATCTTGG + Intergenic
1147286365 17:39405291-39405313 AACTCGGGATTCTTTGATCTGGG + Intronic
1147651581 17:42065254-42065276 CCCTCCTGACACCTTGATCTTGG + Intronic
1148371515 17:47103124-47103146 CCCTTTGGAAACTTTGATCTTGG + Intergenic
1149009611 17:51841774-51841796 ACCTGTGGACACCTTGCTCTGGG - Intronic
1149388100 17:56162348-56162370 CCCTCTTGACACCTTGATCTTGG - Intronic
1150881177 17:69030254-69030276 ATCTATTGACACCTTGATCTTGG - Intronic
1151830342 17:76545559-76545581 GACTCTGGACACCTTGCTCTTGG - Intronic
1153447539 18:5190697-5190719 ACTGGTTGACACTTTGATCTTGG - Intronic
1155078005 18:22379684-22379706 CCCTGTGGACACTTTGATTTTGG + Intergenic
1155280642 18:24236081-24236103 CCCTGTGGACACCTTGATGTTGG + Intronic
1155347459 18:24872808-24872830 ACCTTCGGACACTTTGATCTTGG - Intergenic
1155847010 18:30720662-30720684 ACCTCCCAGCACTTTGATCTTGG - Intergenic
1156241510 18:35259129-35259151 ACCTGCTGACACATTGATCTTGG - Intronic
1156838367 18:41582600-41582622 CCCTGTTGACACTTTGATTTTGG + Intergenic
1156917078 18:42474281-42474303 ACCTCGTGACACCTTGATTTGGG - Intergenic
1157310371 18:46548133-46548155 ATCTCTGGACGCTGTGGTCTGGG + Intronic
1158883517 18:61804250-61804272 ATCTCTCAGCACTTTGATCTTGG - Intergenic
1158949345 18:62477735-62477757 ACCTATTGACACCTTCATCTTGG + Intergenic
1159270385 18:66141617-66141639 ATCTCCTGACACTTTGGTCTTGG + Intergenic
1159326843 18:66931440-66931462 ACCTGCCGACACTTTGACCTTGG - Intergenic
1159820271 18:73132289-73132311 CCCTGTGGACCCCTTGATCTTGG + Intergenic
1160076124 18:75679447-75679469 TCCTCTGGACACCTTGATTTCGG - Intergenic
1160542168 18:79629865-79629887 ACCTCTGGGCAGGTTAATCTGGG - Intergenic
1161985192 19:7649417-7649439 ACCTGTGGACATCTTCATCTTGG - Intergenic
1164577803 19:29416276-29416298 ACCTGTGGACGCCTTGATCTTGG - Intergenic
1166266582 19:41688302-41688324 ACCCCTGGACCATGTGATCTTGG - Exonic
1168467096 19:56611801-56611823 TCCTGTGGATACTTTGATCAGGG - Intronic
1168682147 19:58323828-58323850 ACCTGTTGACACCTTGATCTGGG + Intergenic
925485630 2:4326447-4326469 ACCTTTGGATTCTTTGCTCTTGG + Intergenic
925881287 2:8354951-8354973 ACCTGTCGTCACCTTGATCTTGG - Intergenic
925980546 2:9173637-9173659 CCCTATTGACACCTTGATCTTGG - Intergenic
926360607 2:12083122-12083144 ACCTTTGGAAACTTGCATCTGGG + Intergenic
926814247 2:16784591-16784613 ACCTGTCAACACCTTGATCTTGG + Intergenic
926841577 2:17086769-17086791 CCCTGTTGACACTTTGCTCTTGG + Intergenic
927122227 2:19976557-19976579 ACCTGTTGACATCTTGATCTTGG + Intronic
927287242 2:21369602-21369624 GCCACTGGACTCCTTGATCTTGG - Intergenic
927481244 2:23456048-23456070 ACCTGCTGACACTTTGATCTTGG + Intronic
928395884 2:30943088-30943110 CCCTGTGGACACCTTAATCTCGG + Intronic
929116583 2:38449557-38449579 AACTCTGAACAGTGTGATCTTGG + Intergenic
932908476 2:75780424-75780446 ACCTGCTGGCACTTTGATCTTGG - Intergenic
933196103 2:79391857-79391879 TCCTTTGGACACCTTGATCTAGG - Intronic
934052413 2:88221677-88221699 ACCTGCTGACACCTTGATCTTGG - Intergenic
935366959 2:102304693-102304715 AACTCTAGACACTTCTATCTGGG - Intergenic
936347569 2:111686903-111686925 ACCTGCTGACACCTTGATCTTGG + Intergenic
936396733 2:112137411-112137433 ATCTATTGACACCTTGATCTTGG + Intergenic
936490880 2:112971100-112971122 AACTATTGACACCTTGATCTTGG + Intergenic
936644348 2:114351285-114351307 ACCTGCTGACACCTTGATCTTGG + Intergenic
937122147 2:119448155-119448177 ACCTGTCGACACCTTGATCTTGG + Intronic
938572761 2:132576008-132576030 ATCTCTTGGCACCTTGATCTTGG + Intronic
938797584 2:134731323-134731345 TCCTGTAGACACCTTGATCTTGG + Intergenic
940261193 2:151781220-151781242 ACATCTAGACTCTGTGATCTTGG - Intergenic
941156088 2:161980141-161980163 ACCTCCAGACACACTGATCTTGG - Intronic
942068013 2:172290110-172290132 CCCTATTGACACGTTGATCTTGG - Intergenic
942511841 2:176710653-176710675 AACTCTGGACACTTTGAAGGTGG + Intergenic
943683655 2:190793858-190793880 ACCTGCTGACACCTTGATCTTGG - Intergenic
943899927 2:193420598-193420620 ATCTCTGGAAACTTTTTTCTAGG + Intergenic
944343787 2:198635979-198636001 CTCTGTTGACACTTTGATCTTGG + Intergenic
947014712 2:225606265-225606287 ACCTCTGGACACTTTGATCTGGG - Intronic
947260848 2:228220318-228220340 CCCTATAGACACCTTGATCTTGG + Intergenic
948360666 2:237417823-237417845 ATCTGCGGGCACTTTGATCTTGG + Intergenic
1168926731 20:1587844-1587866 CCCTGCTGACACTTTGATCTTGG + Intronic
1169330081 20:4709451-4709473 ACCTGCTGACACTTTGATGTTGG - Intergenic
1169639838 20:7739502-7739524 ACCTCTTGACACCTTAATCTTGG - Intergenic
1169814927 20:9646546-9646568 ACTTCTTGACACTTTGGTTTGGG - Intronic
1173881271 20:46414276-46414298 ATCTGATGACACTTTGATCTTGG - Intronic
1174099230 20:48114462-48114484 ATCTGATGACACTTTGATCTTGG + Intergenic
1174372248 20:50099281-50099303 ACCTGCTGACACCTTGATCTTGG + Intronic
1175363304 20:58432109-58432131 AGCTCTGGACACAGTGCTCTTGG + Intronic
1177127387 21:17212400-17212422 ACCTGCAGCCACTTTGATCTTGG + Intergenic
1177347404 21:19891313-19891335 GCCTATGGACACTTTAGTCTAGG + Intergenic
1177352899 21:19967933-19967955 ACCTTGTGACACATTGATCTTGG + Intergenic
1177730863 21:25025394-25025416 AACTTTTGACACCTTGATCTTGG - Intergenic
1178242935 21:30923377-30923399 ACCTGCAGATACTTTGATCTTGG - Intergenic
1178824156 21:36001570-36001592 ACCCGTGGACACCTTGATCTTGG - Intronic
1179708929 21:43200624-43200646 ACCTGATGACACCTTGATCTTGG - Intergenic
1181912215 22:26247644-26247666 CCCTCCTGACACTCTGATCTTGG + Intronic
1183475383 22:38033400-38033422 ACCTCTAGACTCTGGGATCTGGG - Intronic
1184006084 22:41710250-41710272 ATCTGCTGACACTTTGATCTTGG + Intronic
1184543773 22:45151066-45151088 CCCTGCTGACACTTTGATCTTGG - Intergenic
1184622642 22:45693867-45693889 CCCTCTCGACACCTTGATCTTGG + Intronic
1184923306 22:47620673-47620695 ACCTCTCGACATTTTGGTTTTGG - Intergenic
1185149197 22:49154422-49154444 TCCTCAGGAGACTTTGCTCTGGG + Intergenic
1185163857 22:49245662-49245684 CCCTGCTGACACTTTGATCTCGG - Intergenic
949301659 3:2591200-2591222 ACATCTGGACAATGTGATCATGG - Intronic
949307251 3:2656365-2656387 ACTTCTGGGCAATTTAATCTGGG - Intronic
949842789 3:8338256-8338278 ACTTCTGGACACTTTTATTTTGG - Intergenic
950697264 3:14712354-14712376 CCCTGTTGACACCTTGATCTTGG + Intronic
951160478 3:19413668-19413690 TCCTGCTGACACTTTGATCTCGG + Intronic
951271800 3:20634247-20634269 ACCTACAGTCACTTTGATCTTGG + Intergenic
952215883 3:31277932-31277954 ACCTGTGGACAACTTGATCTTGG - Intergenic
952939275 3:38429509-38429531 ATCTGTGAACACCTTGATCTTGG - Intergenic
953298515 3:41747826-41747848 ACCTGTCGACACCTTGATCTTGG + Intronic
954869003 3:53752697-53752719 ACCTTTGGACACTTTGATCTGGG + Intronic
955157137 3:56427774-56427796 ACCTGCTGACACCTTGATCTTGG + Intronic
955854122 3:63254979-63255001 GCCTTTAGACACCTTGATCTTGG + Intronic
955989864 3:64615104-64615126 ACCTCAGGGCACTTTGGGCTTGG - Intronic
956687258 3:71841540-71841562 ACCTGCGGGCACCTTGATCTTGG + Intergenic
956762678 3:72457761-72457783 ACCTGCTGACACCTTGATCTTGG + Intergenic
957313800 3:78551804-78551826 ACCTGTAGGCACCTTGATCTTGG + Intergenic
957958883 3:87224893-87224915 ACCTCTGGGTTCCTTGATCTTGG + Intergenic
959633725 3:108537627-108537649 ACCTGTTGGCACTTTGATCATGG + Intergenic
959906551 3:111716999-111717021 ATCTGATGACACTTTGATCTTGG + Intronic
960065955 3:113372858-113372880 ACCTGCTGACACCTTGATCTTGG + Intronic
961535878 3:127570226-127570248 AACAGTGGACACCTTGATCTTGG + Intergenic
962205307 3:133429344-133429366 ACCTGCTGACACTTTGATCTTGG - Intronic
963045567 3:141100536-141100558 CCCTGTAGACACCTTGATCTTGG + Intronic
963327320 3:143876975-143876997 ATCTCTTGTCACCTTGATCTTGG - Intergenic
963390880 3:144662829-144662851 ACCTGCTGACGCTTTGATCTTGG - Intergenic
963907142 3:150782158-150782180 ACCTGTCAACACCTTGATCTTGG + Intergenic
964272128 3:154968035-154968057 ACCTGTGGACACCTTGGTCTTGG - Intergenic
965248437 3:166308194-166308216 GCCTATTGACACTTTGGTCTTGG - Intergenic
965524259 3:169699827-169699849 ACCTCTGGACACATGCAGCTGGG + Intergenic
965525148 3:169708438-169708460 ATCTGTTGACACCTTGATCTTGG + Intergenic
965746313 3:171929483-171929505 AACTATGGGCACCTTGATCTTGG + Intronic
965928037 3:174007208-174007230 ACCTGTCAACACCTTGATCTAGG + Intronic
966042759 3:175511525-175511547 ACCTGTGAACATGTTGATCTTGG + Intronic
966632580 3:182095019-182095041 ATCTCCTGGCACTTTGATCTTGG - Intergenic
966791603 3:183676144-183676166 ATCTATGCACACATTGATCTCGG + Intronic
967698804 3:192567578-192567600 CCCTGTGGACACCTTGATTTTGG - Intronic
967808450 3:193735256-193735278 ACCTCCTGACACTGTGACCTTGG + Intergenic
967964425 3:194949830-194949852 ACCTGCTGACACCTTGATCTTGG - Intergenic
969040434 4:4291234-4291256 ACCTGAAGACACCTTGATCTTGG - Intronic
969843706 4:9902569-9902591 CCCTGCAGACACTTTGATCTTGG - Intronic
969854990 4:9991813-9991835 ACCTGCCGACACTTTGATCTTGG + Intronic
969999676 4:11352404-11352426 ACCTGTTGACCCTTTGACCTTGG - Intergenic
970067013 4:12107121-12107143 ACCTGTGAATACCTTGATCTTGG - Intergenic
970367336 4:15373141-15373163 ACCTGTTGGCACCTTGATCTTGG - Intronic
970417237 4:15871403-15871425 CCCTATGGACATCTTGATCTTGG + Intergenic
970838510 4:20439338-20439360 CCCTGTGGACACCTTGATCTTGG - Intronic
971228713 4:24779572-24779594 ATCTGTGGACACCTTGATCTTGG + Intergenic
971526423 4:27624165-27624187 TCCTGTGGACACCTTGATTTCGG + Intergenic
971587987 4:28430475-28430497 ATCTCTGGATACTTTGGTTTGGG + Intergenic
972597983 4:40547000-40547022 TACTCTGGTCCCTTTGATCTTGG - Intronic
972855867 4:43105785-43105807 ACCTGCTGACACCTTGATCTGGG + Intergenic
972869002 4:43272887-43272909 ACCTGTGAACACCTTGATTTTGG - Intergenic
974033228 4:56794919-56794941 GCCCCGGAACACTTTGATCTTGG + Intergenic
974109848 4:57512555-57512577 ACCTCTGGGCACTCTGCTCCAGG + Intergenic
974338746 4:60586562-60586584 ACCTTGTGACACCTTGATCTTGG + Intergenic
974804646 4:66862113-66862135 CCTTGTGGACACCTTGATCTTGG - Intergenic
974844443 4:67334407-67334429 ACCTGTGAACACTTTGGTCTTGG - Intergenic
975208800 4:71675219-71675241 CCCTCTGGACACTATGGTCTAGG - Intergenic
975417489 4:74121953-74121975 ACCTGTTGAAACCTTGATCTTGG + Intronic
975987486 4:80214912-80214934 ACCTGTCAACACTTTGTTCTTGG + Intergenic
976316962 4:83668780-83668802 AGCTCTGTACATTTTGCTCTTGG + Intergenic
976467584 4:85388250-85388272 ACCTGCTGACACCTTGATCTTGG + Intergenic
976888664 4:90016887-90016909 ACCTACTGACACCTTGATCTTGG + Intergenic
978402362 4:108344074-108344096 ACCTATGGACACTTTGAGGAAGG - Intergenic
978630502 4:110738539-110738561 TCCTCCCAACACTTTGATCTTGG + Intergenic
978716328 4:111847417-111847439 ACATCTGGAAACTTTGATCTGGG - Intergenic
979028497 4:115608217-115608239 ACCTGCTGACACTTTCATCTTGG - Intergenic
979565271 4:122147656-122147678 ACCTCCTGACACCTTGCTCTTGG + Intergenic
980127857 4:128790647-128790669 CCCTGTGGACACCTTGATTTTGG - Intergenic
980980546 4:139651022-139651044 ACCTATCCACACCTTGATCTTGG + Intergenic
981788297 4:148505425-148505447 ACCTGCTGACACCTTGATCTTGG + Intergenic
982100016 4:151958562-151958584 CCCTGCTGACACTTTGATCTTGG - Intergenic
982116722 4:152104356-152104378 ATCTGCGGACACCTTGATCTTGG + Intergenic
982951535 4:161703135-161703157 ACCTACTGACACCTTGATCTTGG + Intronic
984425003 4:179572063-179572085 ACCTCTTGACACTTTCATTTTGG + Intergenic
985041878 4:185899033-185899055 GCCTCTGCACACTGTGATCATGG - Intronic
985644222 5:1077556-1077578 ACCTCTGGACACGTGGCTGTGGG + Intronic
986643560 5:9894549-9894571 ACCTGCAGACACCTTGATCTTGG + Intergenic
987173811 5:15286449-15286471 AGCCCTGGACACTTTGAACAGGG + Intergenic
987809312 5:22813183-22813205 ACCTCTTGATTCTATGATCTGGG + Intronic
988005079 5:25400227-25400249 ACCTGTTGACACTTTGATTTTGG - Intergenic
988716655 5:33835501-33835523 ATCTATAGGCACTTTGATCTTGG - Intronic
988798962 5:34678624-34678646 CCCTGTTGACACCTTGATCTTGG + Intronic
989096332 5:37785263-37785285 ATTTCTGGACACTCTGATTTTGG - Intergenic
989651924 5:43700023-43700045 AAATCTGCACACTTTGTTCTTGG - Intronic
990804682 5:59645654-59645676 AGCTCTGGGCACATTGATTTTGG - Intronic
990977465 5:61572276-61572298 CCCTGCTGACACTTTGATCTTGG + Intergenic
991142352 5:63259451-63259473 ATCTATTGGCACTTTGATCTTGG + Intergenic
991162575 5:63521472-63521494 ACCTGTTGATACTTTGATCTTGG + Intergenic
991525420 5:67551713-67551735 ACCTGTTGACACCTTGTTCTTGG - Intergenic
991613264 5:68469820-68469842 CCCTGTGGACACGTTGATCATGG + Intergenic
991618030 5:68517297-68517319 GCCTTTGGAAACTTTGACCTGGG + Intergenic
991696342 5:69276600-69276622 TCCACTGGACAGTTTGGTCTTGG - Exonic
992748147 5:79838759-79838781 ACCTCTTGACACTGCGCTCTCGG + Intergenic
993159961 5:84277347-84277369 ATCTGCGGACACCTTGATCTTGG + Intronic
993353008 5:86873075-86873097 ACTTGTTGACACATTGATCTTGG - Intergenic
993639322 5:90382844-90382866 ACCTGCGAACACATTGATCTTGG - Intergenic
994251796 5:97544347-97544369 CCCTATTGACACCTTGATCTTGG + Intergenic
995173308 5:109143038-109143060 ACTTCTGGCCACTTTAATTTAGG + Intronic
995224191 5:109685806-109685828 ACCCGCTGACACTTTGATCTTGG - Intergenic
995548522 5:113256663-113256685 ACTTCTGGACATGTTGACCTTGG + Intronic
995630286 5:114125574-114125596 CCCTGTGGACGCCTTGATCTTGG - Intergenic
996002108 5:118376886-118376908 ACCTGTCAACACCTTGATCTGGG - Intergenic
996581756 5:125039048-125039070 CCATCCTGACACTTTGATCTTGG - Intergenic
996890502 5:128413069-128413091 AGCTTTGGACATTTTGATCCTGG + Intronic
997911036 5:137873614-137873636 AGATTTTGACACTTTGATCTAGG + Intronic
998191897 5:140032461-140032483 ACCTTTGGACATTTTGATGAGGG - Intronic
1000017320 5:157289477-157289499 ACCTACAGACACCTTGATCTTGG - Intronic
1001350050 5:170952828-170952850 ATCTCTGGATTCATTGATCTAGG - Intronic
1001452913 5:171839945-171839967 CCCTGCTGACACTTTGATCTTGG + Intergenic
1001893384 5:175358311-175358333 ACCTCTCCACACTTCGTTCTAGG + Intergenic
1003191292 6:3877669-3877691 ACCTGCTGACACCTTGATCTTGG - Intergenic
1004267818 6:14164673-14164695 ACCTATTGACACTTTGATCTTGG + Intergenic
1004310331 6:14539910-14539932 GCCTGTGGACACCTGGATCTCGG + Intergenic
1004336603 6:14769963-14769985 ATCTGTTGACACCTTGATCTTGG + Intergenic
1005214537 6:23509685-23509707 ACCTGATGGCACTTTGATCTTGG + Intergenic
1005308969 6:24541199-24541221 ACCTGCCGACACCTTGATCTCGG - Intergenic
1005756911 6:28933156-28933178 AACCCTGCAGACTTTGATCTTGG - Intergenic
1006086840 6:31601789-31601811 ACCTCTGTAGACTTTTTTCTTGG + Intergenic
1009400893 6:63254336-63254358 ACCTGAGGACACCTTGATTTTGG - Intergenic
1009635270 6:66257502-66257524 ACCTGCTGGCACTTTGATCTTGG - Intergenic
1010082734 6:71883194-71883216 ACCTGTTGACACCTAGATCTTGG + Intergenic
1011021959 6:82824644-82824666 ACCTGTGGACACTGCTATCTTGG - Intergenic
1011771740 6:90680883-90680905 TCCTGTTGAGACTTTGATCTTGG - Intergenic
1012849436 6:104429252-104429274 ACCTCTTGGCACTTTGATCCTGG + Intergenic
1013415228 6:109918771-109918793 GCCTCTTGACACCTTGATCTTGG - Intergenic
1013448197 6:110252284-110252306 ACCTGCTGACACGTTGATCTTGG - Intronic
1013593456 6:111640502-111640524 ACCTGCTGACACCTTGATCTTGG + Intergenic
1013611050 6:111795382-111795404 ACCTGCTGACACTTTGATCTCGG + Intronic
1015210094 6:130687166-130687188 ATCTGCTGACACTTTGATCTGGG - Intergenic
1015706530 6:136094052-136094074 ACCTGTTGGCACCTTGATCTTGG - Intronic
1015873282 6:137798558-137798580 ACCTGTGGGCACCTTGATCTTGG - Intergenic
1016304050 6:142665100-142665122 ATCTGTGAGCACTTTGATCTTGG - Intergenic
1016368199 6:143341652-143341674 ACCTGCTGACACCTTGATCTTGG + Intergenic
1016887891 6:148975492-148975514 CACACTGGACACTTTGATCATGG - Intronic
1016888474 6:148981955-148981977 ACCTGCTGGCACTTTGATCTTGG - Intronic
1016985925 6:149895866-149895888 ACCTGCTGACACCTTGATCTTGG - Intronic
1018089149 6:160330436-160330458 TCCTGTTGACACCTTGATCTTGG + Intergenic
1018151711 6:160945811-160945833 GCCTCTGGACACTGACATCTGGG + Intergenic
1018951433 6:168381041-168381063 CCCTGTGGACACTTTGACTTGGG - Intergenic
1020254193 7:6492950-6492972 ACCTGCTGACACTTTGATCTTGG + Intergenic
1020490766 7:8781115-8781137 ACCTATTGGCACCTTGATCTTGG + Intergenic
1020501700 7:8931082-8931104 ACCTGCTGACACCTTGATCTTGG + Intergenic
1022214392 7:28243842-28243864 ACCTGCTGACACCTTGATCTTGG + Intergenic
1022246122 7:28561266-28561288 AGCTCTGAACACTTTGATGATGG - Intronic
1023106622 7:36769355-36769377 ACCTCCCAACACTTTGATCTTGG - Intergenic
1024028063 7:45431166-45431188 ACCTGCCGACACCTTGATCTTGG + Intergenic
1024043267 7:45571158-45571180 CCCTGCCGACACTTTGATCTCGG - Intergenic
1024546986 7:50530388-50530410 CCCTGTGGACACTTTGATTTTGG + Intronic
1024611225 7:51065972-51065994 CCCTGCCGACACTTTGATCTCGG + Intronic
1027836286 7:83248255-83248277 ACCTGCCAACACTTTGATCTTGG + Intergenic
1028485410 7:91352165-91352187 ATCTGTGGACACCTTGATCTTGG - Intergenic
1028635128 7:92979875-92979897 ACCTGCTGACACTCTGATCTTGG - Intergenic
1029989719 7:104952204-104952226 ATCACTGGGCTCTTTGATCTTGG - Intergenic
1030646261 7:112064948-112064970 ACCTGCTGGCACTTTGATCTTGG + Intronic
1030650025 7:112107484-112107506 ACCTATGGACACCTTTATCTTGG + Intronic
1031258321 7:119484508-119484530 TCCTGTTGACACTTTTATCTTGG + Intergenic
1031524473 7:122807649-122807671 ACCTGCCAACACTTTGATCTTGG - Intronic
1031908431 7:127487660-127487682 ACCTGCCGACACCTTGATCTTGG + Intergenic
1032991038 7:137395356-137395378 ACCTCTGAACACGTTGACCTTGG - Intronic
1033122229 7:138676375-138676397 ACCTGCTGGCACTTTGATCTTGG - Intronic
1033832155 7:145267636-145267658 ACATGTGGACACCTTGGTCTTGG + Intergenic
1034362262 7:150510384-150510406 ACCTGTCAATACTTTGATCTTGG + Intergenic
1034992121 7:155554571-155554593 CCCTCCTGACACCTTGATCTTGG - Intergenic
1035725106 8:1819460-1819482 ACCTGTTGGCACGTTGATCTTGG - Intergenic
1036508505 8:9378925-9378947 CCCTCTTGACACCTTGATCTTGG - Intergenic
1037129431 8:15389829-15389851 ACCTGCCGACACTTTGATCTTGG - Intergenic
1038139363 8:24826293-24826315 ACCTGCTGACACTTTGATATTGG + Intergenic
1038520079 8:28224396-28224418 ACCTGCTGACACCTTGATCTTGG + Intergenic
1038923136 8:32108324-32108346 ACCTGCTGGCACTTTGATCTTGG - Intronic
1039440607 8:37592713-37592735 ACTTATGGACACATAGATCTGGG + Intergenic
1039737189 8:40345361-40345383 ACCTGCTGACACCTTGATCTGGG - Intergenic
1040498349 8:47986558-47986580 ACCTATTGGCACTTTGCTCTTGG - Intergenic
1040618201 8:49061358-49061380 CCCTGTGGACACATTCATCTAGG + Intronic
1041041668 8:53852523-53852545 ACCTTTGGAAACTTTGAATTTGG - Intronic
1041734422 8:61094786-61094808 ACCTGCTGACACCTTGATCTTGG + Intronic
1042053932 8:64742606-64742628 CCCTGTGGACACCTTGATCTTGG - Intronic
1042053937 8:64742634-64742656 CCCTGTTGACACCTTGATCTTGG - Intronic
1042054009 8:64743492-64743514 CCCTGTGGACACCTTGATCTTGG - Intronic
1042054014 8:64743520-64743542 CCCTGTTGACACCTTGATCTTGG - Intronic
1042190822 8:66185479-66185501 CTCTGTTGACACTTTGATCTTGG - Intergenic
1042455816 8:69001403-69001425 CCCTATTGACACTATGATCTTGG - Intergenic
1042652874 8:71062327-71062349 ATCTCTTGACACCTTGGTCTTGG - Intergenic
1043351011 8:79360722-79360744 ACCTCTGGACACTGAAAGCTTGG - Intergenic
1044777426 8:95705464-95705486 ACCTGCCAACACTTTGATCTTGG + Intergenic
1044875364 8:96660182-96660204 ACATGCAGACACTTTGATCTTGG - Intronic
1045554489 8:103202430-103202452 ACCTGTTGACACCTTGATCTTGG + Intronic
1045611077 8:103842863-103842885 ACCTCCTGACACGTTGATCTTGG - Intronic
1045640700 8:104247290-104247312 ACCTGCAGACACCTTGATCTTGG - Intronic
1046695827 8:117338122-117338144 ATCTCCTGACACATTGATCTTGG - Intergenic
1046817286 8:118598442-118598464 ACCTGCTGACACCTTGATCTTGG + Intronic
1048049993 8:130807619-130807641 ACCTGCTGGCACTTTGATCTTGG + Intronic
1048150291 8:131887219-131887241 CCCTGTTGACACCTTGATCTTGG - Intergenic
1048195058 8:132325664-132325686 CCCTGTTGACACCTTGATCTTGG + Intronic
1048393913 8:133994787-133994809 CCCTGTTGACACCTTGATCTTGG + Intergenic
1048978449 8:139689150-139689172 ACCTGCTGACACCTTGATCTTGG + Intronic
1050025579 9:1331340-1331362 ACCTCTTGGCACCTTAATCTTGG + Intergenic
1050758582 9:9038290-9038312 ACCACAGGACAGTTTGGTCTAGG + Intronic
1050928888 9:11300207-11300229 ACTTGAGGACACCTTGATCTTGG - Intergenic
1051699328 9:19803038-19803060 ATCTGTTGACACTTTGATCTTGG + Intergenic
1052199222 9:25757543-25757565 ACCTTTTGACACTTTGATCTAGG + Intergenic
1052944699 9:34158883-34158905 ACCTCCTGACACCTTGACCTTGG + Intergenic
1054918047 9:70513898-70513920 ACCTCTAGAGATTTTGAGCTGGG - Intergenic
1056442483 9:86634670-86634692 ACCTGCTGACACCTTGATCTTGG - Intergenic
1056442505 9:86634810-86634832 ACCTGCTGACACTGTGATCTTGG - Intergenic
1057085262 9:92204148-92204170 ACCTGCTGACACCTTGATCTTGG + Intergenic
1059067811 9:111103699-111103721 ACCTAATGACACCTTGATCTTGG + Intergenic
1059472308 9:114514933-114514955 CCCTGTTGACACCTTGATCTTGG - Intergenic
1059496642 9:114715393-114715415 CCCTGCTGACACTTTGATCTTGG - Intergenic
1059785614 9:117579435-117579457 ATCTATGGGCACGTTGATCTTGG + Intergenic
1060540236 9:124424335-124424357 ATCTCCGGGCACTCTGATCTTGG - Intergenic
1060619165 9:125047346-125047368 ACCTGCTGACACCTTGATCTTGG + Intronic
1060706826 9:125810585-125810607 ACTTGTGGACATTTTTATCTGGG + Intronic
1061253948 9:129442824-129442846 ACCTGCTGACACCTTGATCTTGG + Intergenic
1061439826 9:130593705-130593727 ACCACTGAAGACTTTGCTCTGGG + Intronic
1185923001 X:4114756-4114778 ACCTGCTGACACCTTGATCTTGG - Intergenic
1186001035 X:5010854-5010876 CTCTGTGGACACCTTGATCTTGG - Intergenic
1186014428 X:5175114-5175136 CCCTATGAACACTATGATCTTGG - Intergenic
1186146732 X:6632078-6632100 CCCTGGGGACACCTTGATCTTGG - Intergenic
1186173027 X:6897690-6897712 ATCTGCGGGCACTTTGATCTTGG - Intergenic
1186569828 X:10702985-10703007 ATCTGTGGACACCTTGATCTTGG + Intronic
1187329171 X:18320096-18320118 ATCTGAGGGCACTTTGATCTTGG + Intronic
1187629127 X:21148544-21148566 ACCTCAGGAAACTTAGATCATGG - Intergenic
1188121055 X:26308473-26308495 TCCTGTTGACACTTTGGTCTTGG - Intergenic
1189367115 X:40397396-40397418 ACCTGCTGACACCTTGATCTTGG - Intergenic
1189721211 X:43920462-43920484 TCCTGCTGACACTTTGATCTTGG + Intergenic
1189924178 X:45935636-45935658 ACCACTGGACACTCAGTTCTGGG - Intergenic
1190223587 X:48528995-48529017 ACCTGCTGACACCTTGATCTTGG - Intergenic
1190383827 X:49865132-49865154 ACCTATTGGCACCTTGATCTTGG + Intergenic
1191890996 X:65940788-65940810 ACCTGATGGCACTTTGATCTTGG - Intergenic
1192138648 X:68629962-68629984 ACCTCTGGCCCCTTTGAGATGGG - Intergenic
1192305152 X:69951334-69951356 ACCTGTTGGCACCTTGATCTTGG + Intronic
1195578648 X:106477652-106477674 TCTTCTGGATACTTTGTTCTAGG - Intergenic
1195866707 X:109440145-109440167 ACCTGTTGGCACCTTGATCTTGG - Intronic
1198505406 X:137296254-137296276 ACCACAGTACATTTTGATCTTGG + Intergenic
1198574038 X:137990510-137990532 ACCTGTTGACCCCTTGATCTTGG - Intergenic
1199180063 X:144843546-144843568 ACCTGCTGACACCTTGATCTTGG + Intergenic
1200423926 Y:3002334-3002356 ACCTATGGACAGATTCATCTTGG - Intergenic