ID: 947017327

View in Genome Browser
Species Human (GRCh38)
Location 2:225635730-225635752
Sequence CTGCATTTATAGATGGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 402}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947017323_947017327 -1 Left 947017323 2:225635708-225635730 CCCTTTTTGGGTTGCCTTGAGTC 0: 1
1: 1
2: 1
3: 8
4: 145
Right 947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG 0: 1
1: 0
2: 1
3: 31
4: 402
947017324_947017327 -2 Left 947017324 2:225635709-225635731 CCTTTTTGGGTTGCCTTGAGTCT 0: 1
1: 0
2: 2
3: 6
4: 191
Right 947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG 0: 1
1: 0
2: 1
3: 31
4: 402
947017321_947017327 11 Left 947017321 2:225635696-225635718 CCAGTGTGATGACCCTTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
Right 947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG 0: 1
1: 0
2: 1
3: 31
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947017327 Original CRISPR CTGCATTTATAGATGGAATT TGG Intronic
904495534 1:30884374-30884396 CTGCCTTTGTAGATGGGAGTAGG - Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904983804 1:34528075-34528097 GTGCATCAATAAATGGAATTGGG - Intergenic
905433439 1:37941041-37941063 CTGCAGTACTAGATGGAACTGGG + Intronic
906131160 1:43457933-43457955 CTGCCTTCATAGAATGAATTAGG - Intergenic
906582423 1:46947071-46947093 CTGTCTTTGTAGATGGATTTTGG - Intergenic
907602736 1:55787184-55787206 CTGTCTTTGTAGATGGATTTTGG + Intergenic
907785124 1:57603945-57603967 CAGCATTCATAGAGGGATTTGGG - Intronic
907878971 1:58525640-58525662 TTGCATTTATACATGAATTTGGG - Intronic
908614288 1:65900522-65900544 CTGAATTTATAGATTGCTTTGGG + Intronic
908661291 1:66438264-66438286 CTGCTATTATAGATGCAGTTAGG - Intergenic
909056340 1:70825522-70825544 CTGCAGATAGAGATGGAATAAGG + Intergenic
909338544 1:74505277-74505299 CTGCCTGTATAGATTTAATTAGG - Intronic
909490892 1:76225282-76225304 CTGCATCTATATATAGAAATGGG - Intronic
910236280 1:85039575-85039597 CTGCATTTCCAGAAGGAATGTGG + Intronic
911425731 1:97708704-97708726 CTGAATCTATAGATCTAATTGGG + Intronic
911613725 1:99985633-99985655 CTGCATTTATAGATTGCTTTTGG + Intronic
911669094 1:100587964-100587986 CTACATTTCTAGATGAGATTTGG - Intergenic
912027443 1:105195384-105195406 CTGCATTTACCTATGTAATTTGG - Intergenic
913470587 1:119181966-119181988 CTGTCTTTGTAGATGGATTTTGG + Intergenic
914007199 1:143742763-143742785 CTGCATATATAGGTAAAATTAGG - Intergenic
914356443 1:146888629-146888651 TTTCATTTATAGATAGCATTTGG + Intergenic
914511914 1:148340827-148340849 TTGAATTTATAGATCAAATTAGG + Intergenic
914646016 1:149653257-149653279 CTGCATATATAGGTAAAATTAGG - Intergenic
917763104 1:178185890-178185912 CTGGCTTCATAGATTGAATTAGG + Intronic
917898172 1:179513569-179513591 CTGCCTTCATAGAATGAATTAGG + Intronic
917907691 1:179603882-179603904 CTGGTTTTATAGAATGAATTAGG + Intronic
920594416 1:207254849-207254871 CTACAATTCAAGATGGAATTTGG + Intergenic
921172622 1:212562676-212562698 AAGCATTTATTAATGGAATTAGG + Intergenic
921242279 1:213197351-213197373 CTGAATTTATAGATTGCTTTTGG + Intronic
923447203 1:234082904-234082926 CTGCAATTAAAGATGAGATTTGG + Intronic
924291747 1:242543511-242543533 CTACATTTATAGATTGATTTGGG + Intergenic
1063132669 10:3192210-3192232 GTGAATTTATAGATGGAATTTGG + Intergenic
1063445921 10:6116977-6116999 CTTCAGTTATCTATGGAATTAGG + Exonic
1064202544 10:13297111-13297133 TTGCCTTTAGAAATGGAATTAGG + Intronic
1065160473 10:22915830-22915852 CTGCAATTACACATGGAACTTGG + Intergenic
1065352411 10:24807324-24807346 CTGCATTTATGACTGGAATTTGG - Intergenic
1065470663 10:26078002-26078024 CTGGTTTTATAGAATGAATTAGG + Intronic
1065954441 10:30680723-30680745 TTGAATTTATAGATCGAGTTGGG + Intergenic
1066481241 10:35797612-35797634 GTGCATTTATAAATGTAAATTGG - Intergenic
1068214528 10:53967047-53967069 CTGCAATTCAAGATGAAATTTGG - Intronic
1068768356 10:60791093-60791115 CTGAATTTGTAGATTGCATTGGG + Intronic
1069771030 10:70900492-70900514 TTGAATTTATAGATTTAATTTGG + Intergenic
1070348723 10:75571269-75571291 TTGGATGTATAGAGGGAATTAGG + Intronic
1072204506 10:93190773-93190795 CTGGATTTCTCGTTGGAATTTGG + Intergenic
1073672959 10:105612973-105612995 GGGCATTTAAAGATGTAATTAGG - Intergenic
1074123972 10:110513728-110513750 CTGCATTTATGGAATGAAATAGG + Intergenic
1075446416 10:122516547-122516569 TTGGAGTTATAGATGGATTTGGG + Intergenic
1076022123 10:127082630-127082652 CTACAATTAAAGATGCAATTTGG + Intronic
1076077621 10:127548273-127548295 CTGCATTAATAAATGGATTCAGG - Intergenic
1076215239 10:128687950-128687972 CTGCATTTATACTTAGTATTTGG - Intergenic
1078842094 11:15087234-15087256 CTGAATTTATAGATTGCTTTTGG + Intergenic
1079114167 11:17630067-17630089 GTGCATGTGTAGAGGGAATTTGG - Intronic
1079888504 11:26019595-26019617 CTGCATTTAGCGATGTCATTTGG - Intergenic
1080402592 11:31950488-31950510 CTGGCTTTATAGAATGAATTAGG - Intronic
1080738165 11:35037722-35037744 CTGCAGGTATACATGGAAATAGG + Intergenic
1080933037 11:36833442-36833464 CTGGCTTCATAGATTGAATTAGG + Intergenic
1084955849 11:72691145-72691167 CTACACTTATAGATGGCCTTGGG + Intronic
1086187926 11:84041781-84041803 TTACATTTCAAGATGGAATTTGG - Intronic
1086503785 11:87480304-87480326 CTACAATTAAAGATGAAATTTGG - Intergenic
1087982087 11:104628067-104628089 CTTCATTTTTAGAAGGAATCTGG - Intergenic
1088243586 11:107795115-107795137 CTGAATTTATAGATTGCTTTGGG - Intronic
1088838489 11:113601919-113601941 CTGAATTTATAGATGTACTCAGG - Intergenic
1089132320 11:116222420-116222442 CTGCAATTCAAGATGGGATTTGG + Intergenic
1089421536 11:118335591-118335613 TTGCATTTATAGATCAATTTGGG - Intergenic
1090143125 11:124287303-124287325 TTGAATTTATAGATCAAATTGGG + Intergenic
1090588954 11:128244661-128244683 CTGCATTTTCATTTGGAATTGGG - Intergenic
1092642921 12:10536985-10537007 CTACAATTCTAGATGAAATTTGG + Intergenic
1093488198 12:19675793-19675815 CTGAATTTATAGATCAATTTGGG + Intronic
1094179988 12:27582283-27582305 ATGCATTTATACATTTAATTAGG + Intronic
1094462861 12:30716535-30716557 CTACATGTATAGATGGCAGTTGG + Exonic
1095226165 12:39679568-39679590 TTGCATTTATAGATTGCTTTTGG - Intronic
1095733052 12:45526098-45526120 CTGCCTTCATAGAATGAATTAGG - Intergenic
1096270095 12:50158692-50158714 CTCCAGTTATAGATTGAAATCGG - Intronic
1097404985 12:59178027-59178049 CTGCAATTCAAGATGAAATTTGG + Intergenic
1097839171 12:64304492-64304514 CTGCATTTGTTGGTGGAATTAGG - Intronic
1098666914 12:73175869-73175891 CTGTATTTATAACTGGAAATAGG - Intergenic
1098876893 12:75875042-75875064 TTGAATTTATAGATTGATTTTGG - Intergenic
1099204595 12:79712871-79712893 CTACATTTATAGATTGATTTAGG + Intergenic
1099365654 12:81763275-81763297 CTGCATTTATTGTTGCAAGTTGG + Intergenic
1099476769 12:83117256-83117278 CTGGTTTTATAGAATGAATTAGG - Intronic
1099582758 12:84473679-84473701 ATGAATTCATTGATGGAATTAGG + Intergenic
1099821508 12:87716973-87716995 CTGCATTTAATGTTGGAACTTGG - Intergenic
1100775963 12:97974842-97974864 CTGAATTTTTAGATTCAATTTGG + Intergenic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1103887068 12:124210498-124210520 AGGCATTTACAGATGTAATTAGG - Intronic
1104198952 12:126568522-126568544 CTGCAATTCAAGATGAAATTTGG + Intergenic
1104321139 12:127752013-127752035 CTGCAGTTCAAGATGAAATTTGG + Intergenic
1105907331 13:24825731-24825753 CTAAATTTGAAGATGGAATTTGG + Exonic
1106848085 13:33759425-33759447 CTGCATTGATAGAGGGAAATGGG - Intergenic
1107098123 13:36558773-36558795 CTGGATTTACACATGGAAATGGG + Intergenic
1108342170 13:49508030-49508052 TTGCATTTATAGATGAATTTGGG + Intronic
1108850977 13:54728601-54728623 CTACAATTAAAGATGAAATTTGG - Intergenic
1109567493 13:64136273-64136295 CTGAATTTATAGATTGCTTTTGG - Intergenic
1109606941 13:64708292-64708314 CTCCTTTTGTAGATGGATTTTGG + Intergenic
1109608862 13:64737207-64737229 TTGCATGTATAGATGCAATTGGG + Intergenic
1109880401 13:68466301-68466323 CTGAATCTATAGATGGCTTTAGG + Intergenic
1109924809 13:69122736-69122758 TTGAATTTATAGATTGCATTTGG - Intergenic
1110204752 13:72899260-72899282 CTGGCTTTATAGAATGAATTAGG - Intronic
1111424174 13:88057994-88058016 CTGCAATTCAAGATGGAATTTGG - Intergenic
1111702021 13:91702705-91702727 CTGAATCTATAGATGGCTTTAGG + Intronic
1111847368 13:93528362-93528384 GTGAATTTATAGATGGTAGTTGG + Intronic
1111988721 13:95093178-95093200 CTGGCTTTATAGAATGAATTAGG - Intronic
1112582921 13:100691860-100691882 CTGCAGTTCAAGATGAAATTTGG - Intergenic
1112857398 13:103787917-103787939 CTGCAATTCAAGATGAAATTTGG + Intergenic
1114914185 14:27241217-27241239 ATTCATATATTGATGGAATTTGG - Intergenic
1115959049 14:38814145-38814167 TTGAATTTATAGATTGCATTTGG - Intergenic
1115998474 14:39217694-39217716 CTGCAGTTCAAGATGAAATTTGG + Intergenic
1116665161 14:47765398-47765420 CTGCAGTAATAGATGGAGTGGGG + Intergenic
1116667279 14:47793834-47793856 TTAAATTAATAGATGGAATTGGG + Intergenic
1117103440 14:52374224-52374246 CTGCATTTGTAGATTGCTTTTGG + Intergenic
1117560376 14:56931919-56931941 CAGCCTTTATAGAGGGGATTTGG + Intergenic
1120383310 14:83810686-83810708 CTGGCTTTGAAGATGGAATTAGG - Intergenic
1122381728 14:101312055-101312077 CTGAATCTATAGATCAAATTGGG - Intergenic
1124026225 15:25968715-25968737 CTTCATTTAAAGAAGGGATTTGG - Intergenic
1124827479 15:33113130-33113152 CTGCATTTATTGGTGTAATTTGG + Intronic
1124968044 15:34453922-34453944 CTGAATTTATAAATGAATTTTGG + Intergenic
1126757804 15:51941260-51941282 CTGCATTTATATATGACACTGGG - Intronic
1127384373 15:58455123-58455145 CTGTATTTATACATGGACATTGG + Intronic
1127648684 15:60984981-60985003 CTACATTTATTGTTTGAATTTGG + Intronic
1130034821 15:80349186-80349208 TTGAATTTATAGATTGATTTTGG + Intronic
1130140078 15:81218417-81218439 TTGCATTTATAGATGAATTAGGG - Intronic
1130688618 15:86060865-86060887 CTGCATTTCTTAATAGAATTTGG + Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131504477 15:93004402-93004424 GTACATTTAGAGATGGAAATGGG + Intronic
1131693451 15:94851053-94851075 CTGCCTTCATAGAATGAATTAGG + Intergenic
1133504726 16:6400029-6400051 CTGCAATTCAAGATGAAATTTGG + Intronic
1134759188 16:16698464-16698486 CTTCATTAAAAGAGGGAATTTGG + Intergenic
1134760133 16:16707151-16707173 CTGCATTGAAAGTTGGGATTTGG - Intergenic
1134985938 16:18652054-18652076 CTGCATTGAAAGTTGGGATTTGG + Intergenic
1134986885 16:18660720-18660742 CTTCATTAAAAGAGGGAATTTGG - Intergenic
1136714615 16:32268534-32268556 CTGCATTTATAGATAATTTTAGG + Intergenic
1136753292 16:32661213-32661235 CTGCATTTATAGATAATTTTAGG - Intergenic
1136814821 16:33209152-33209174 CTGCATTTATAGATAATTTTAGG + Intronic
1136821297 16:33319232-33319254 CTGCATTTATAGATAATTTTAGG + Intergenic
1136827860 16:33375771-33375793 CTGCATTTATAGATAATTTTAGG + Intergenic
1136832926 16:33474542-33474564 CTGCATTTATAGATAATTTTAGG + Intergenic
1137453361 16:48598041-48598063 TGGCATTTATAGAGGGAGTTGGG - Intronic
1137906591 16:52328950-52328972 CTATATTTATAAATGAAATTAGG + Intergenic
1139977573 16:70826834-70826856 TTTCATTTATAGATAGCATTTGG - Intronic
1140584647 16:76275158-76275180 CTACAGTAATAGAAGGAATTGGG - Intergenic
1141019711 16:80483804-80483826 CTGCAATTCAAGATGAAATTTGG + Intergenic
1141020798 16:80494422-80494444 CTACAGTTATTGGTGGAATTAGG - Intergenic
1141902462 16:87000870-87000892 CTGAATCTATAGATCGATTTGGG - Intergenic
1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG + Intronic
1202993398 16_KI270728v1_random:32126-32148 CTGCATTTATAGATAATTTTAGG + Intergenic
1203055436 16_KI270728v1_random:921235-921257 CTGCATTTATAGATAATTTTAGG - Intergenic
1143208276 17:5162322-5162344 CTGCATTTTTAGTAGGAATGGGG + Intronic
1144242944 17:13331887-13331909 CTGGATTTAAAGATGGAATGAGG + Intergenic
1146917932 17:36690068-36690090 CAGGATTTATAAATGGAATGAGG + Intergenic
1148452493 17:47789286-47789308 CTCCGTTTATAGAAGGAGTTAGG - Intergenic
1148488805 17:48009850-48009872 CTGCATCTATAGAGGAAACTTGG - Intergenic
1149159078 17:53668456-53668478 CTGCAATTCAAGATGAAATTTGG - Intergenic
1151402396 17:73864355-73864377 CTTCATTTACAGATGGAAGCTGG + Intergenic
1153683607 18:7523942-7523964 CTGCTTTTTTGGATGGAATGAGG + Intergenic
1153695149 18:7632716-7632738 CTGGATTTAGGGATGGTATTTGG + Intronic
1154354230 18:13612581-13612603 CTGCAGTTATAGCTGGCATGGGG - Intronic
1155184710 18:23377009-23377031 GTGCTTTGATAGATGGATTTAGG - Intronic
1155887192 18:31222541-31222563 TTGAATTTATAGATTGCATTTGG - Intergenic
1156130361 18:33965514-33965536 CTGCAATTCAAGATGAAATTTGG - Intronic
1156224563 18:35091486-35091508 CTGGATCTATAGATGGCTTTGGG - Intronic
1156285164 18:35686275-35686297 CTGAATTTATATATGAATTTGGG - Intronic
1156939430 18:42747474-42747496 TTGCATTTATAGATTGCTTTTGG - Intronic
1157135541 18:45050768-45050790 CTGAATTTATAGGTAGTATTAGG - Intronic
1157218297 18:45803637-45803659 CAGACTTTATACATGGAATTTGG - Intergenic
1157231111 18:45916872-45916894 CTGCCTTTATTCATGGAGTTGGG - Intronic
1157501722 18:48195280-48195302 CTGCAATTCAAGATGAAATTTGG - Intronic
1157843679 18:50982616-50982638 CTGAATTTATTGCTGGAATATGG - Intronic
1159329217 18:66967712-66967734 CTCCTTTTATTGATGTAATTTGG + Intergenic
1159734616 18:72079162-72079184 ATTCACTTGTAGATGGAATTTGG + Intergenic
1160344360 18:78120737-78120759 CTGCATTTCAACATGGGATTTGG - Intergenic
1164019209 19:21282761-21282783 CTGGCTTAATAGTTGGAATTGGG - Intronic
1164185865 19:22869091-22869113 CTGAATTAGTAGTTGGAATTAGG + Intergenic
1164268195 19:23641786-23641808 CTGGGTTAATAGTTGGAATTAGG - Intronic
1164732528 19:30517121-30517143 CAGCATTTCTGGATGCAATTTGG + Intronic
1165644504 19:37423384-37423406 CTGGTTTTATAAATAGAATTTGG - Intronic
1166170082 19:41022104-41022126 CTGCAATTCTAGATGAGATTTGG + Intergenic
1167350771 19:48973036-48973058 CTACATTTTGAGATGAAATTTGG - Intronic
1168032401 19:53691192-53691214 ATTCATTTAGAGATGGAATCTGG + Intergenic
1168163380 19:54528191-54528213 CTGCAATTCTAGATGAGATTTGG + Intergenic
1168190727 19:54736782-54736804 CTGCATCTTTGGATGGAAATTGG - Intronic
1168192962 19:54753202-54753224 CTGCATCTTTGGATGGAAATTGG - Intronic
1168200867 19:54814663-54814685 CTGCATCTTTGGATGGAAATTGG - Intronic
1168203097 19:54830929-54830951 CTGCATCTTTGGATGGAAATTGG - Intronic
1168208120 19:54867357-54867379 CTGCATCTTTGGATGGAAATTGG - Intergenic
925256243 2:2491045-2491067 CTGCAATTCAAGATGAAATTTGG + Intergenic
927627208 2:24734338-24734360 CTGAATTTACTGATTGAATTTGG - Intronic
928188594 2:29139486-29139508 CTGCTTTCATAGAATGAATTAGG + Intronic
929213320 2:39383460-39383482 CTACAATTAAAGATGAAATTTGG + Intronic
929767820 2:44864038-44864060 CTGAATCTATAGATCAAATTGGG - Intergenic
930214199 2:48677019-48677041 CTGCATTTCTAAATGTATTTGGG + Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
930897958 2:56467749-56467771 CTGGATTTATAGAATGAGTTAGG - Intergenic
931182865 2:59920665-59920687 CTGCATTTGAAGGTGAAATTTGG + Intergenic
931339452 2:61385281-61385303 CTGAATCTATAGATGAATTTCGG - Intronic
931580619 2:63768455-63768477 TTGAATTTATAGATGAAATTGGG + Intronic
932270615 2:70405824-70405846 CTGGATTCATAGAATGAATTAGG - Intergenic
932661647 2:73658918-73658940 TTGAATCTATAGTTGGAATTGGG + Intergenic
932941738 2:76174761-76174783 CTGCATTTGAAGAGGGCATTGGG + Intergenic
932993146 2:76812891-76812913 CTGAATTTATACATTGAAATAGG + Intronic
933139240 2:78773618-78773640 CTGCATTTCAAGATGAGATTTGG - Intergenic
935748551 2:106210557-106210579 CTGTCTTTGTAGATGGATTTTGG - Intergenic
936530634 2:113274690-113274712 CTGTAATTATTGATGGAGTTGGG - Intronic
936633589 2:114231278-114231300 CTGAATTTATAGATTGCTTTTGG + Intergenic
937497633 2:122440198-122440220 CTGAATTTATAGATTAATTTAGG - Intergenic
937743563 2:125384837-125384859 CTGAATCTATAGATCAAATTGGG - Intergenic
939817045 2:146909133-146909155 CTGCATTAATAGTTGGGATGAGG + Intergenic
940206526 2:151208751-151208773 CTATATTTATAGATGAATTTAGG - Intergenic
941830115 2:169947358-169947380 CTGCATTTTTTGTTTGAATTTGG + Intronic
942012807 2:171780004-171780026 CTGAATTTATAGATCAATTTGGG - Intergenic
943091171 2:183376593-183376615 CTTAATTTATTGATGGAATATGG - Intergenic
943265036 2:185718970-185718992 CAGAATTTATACATAGAATTTGG + Intergenic
943392111 2:187283324-187283346 CTGGATTCATAGAATGAATTTGG + Intergenic
943437558 2:187885529-187885551 CTGCAATTCAAGATGAAATTTGG + Intergenic
943643281 2:190382209-190382231 CTGCATTTAAAACTGGCATTGGG + Intergenic
943918636 2:193673431-193673453 TTGAATTTATAGATGAATTTGGG - Intergenic
943956956 2:194204437-194204459 CTGGATTTATAGAATGAGTTAGG + Intergenic
944587750 2:201187371-201187393 CTGAATTTCTTGATGGAATCAGG + Intronic
946972433 2:225109665-225109687 CTCAGTTTATAGCTGGAATTGGG + Intergenic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947317545 2:228877892-228877914 CAGCATGTAAAGATGGTATTTGG - Intronic
948337229 2:237219040-237219062 CAGACTTTATAGAAGGAATTGGG + Intergenic
948649538 2:239432017-239432039 CTGAATTTATAGATTAATTTAGG + Intergenic
1169363874 20:4975234-4975256 CTGCATTCCCAGAAGGAATTGGG - Intronic
1169569161 20:6887954-6887976 CTGGATTTACAGCTGGATTTAGG + Intergenic
1170093060 20:12614057-12614079 CTACAATTCTAGATGGGATTTGG + Intergenic
1170788565 20:19489116-19489138 CTGAATGTATAGATTGAATTAGG - Intronic
1170815439 20:19709750-19709772 CTGCATTTAGAGTTGGACTTTGG - Intronic
1171038332 20:21735499-21735521 CTGAATTTATAGATTGCTTTTGG + Intergenic
1171180948 20:23089975-23089997 CTGCATTTATAGATGAGAAGTGG - Intergenic
1171798994 20:29592291-29592313 TTGCTTTTATACAGGGAATTGGG + Intergenic
1172454384 20:35056254-35056276 CTCCATTTTTAAAAGGAATTGGG + Intronic
1177023240 21:15889157-15889179 CTGGATTTATAGATGAATTTGGG - Intergenic
1177128048 21:17220703-17220725 CTGAATTTCTAGATTGATTTTGG - Intergenic
1177689601 21:24488223-24488245 TTCCATGTATACATGGAATTGGG - Intergenic
1177961103 21:27667216-27667238 TTGCATTTCAAGATGGGATTTGG + Intergenic
1178059671 21:28838177-28838199 CTGCCTTTATAGAACAAATTAGG - Intergenic
1178668576 21:34570105-34570127 CTGCATTTATATAGGGATTTAGG - Intronic
1182965221 22:34515042-34515064 GTGCATTTACAGTTTGAATTTGG - Intergenic
1183768555 22:39902561-39902583 CTGCTTTTTTAGATTGAACTTGG + Intronic
1184613216 22:45619253-45619275 TTGAATCTATAGATGGATTTAGG + Intergenic
949271585 3:2223831-2223853 CTGCACTTACATATGTAATTAGG - Intronic
949607501 3:5670386-5670408 CTGCATGTAAAGATGGTTTTTGG - Intergenic
950292523 3:11797232-11797254 CTGTATTTATAGTTTGAAGTCGG - Intronic
950856813 3:16113488-16113510 CTGCATTTCCAGATGGGTTTTGG - Intergenic
950941083 3:16892248-16892270 CTTCATTTAAAGATGGATCTAGG + Intronic
951295015 3:20922894-20922916 TTGCATTTGTAGATTGCATTTGG - Intergenic
952083161 3:29785152-29785174 CTGGCTTTATAGATTGATTTAGG - Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
953731434 3:45452691-45452713 CTGGCTTTATAGAATGAATTTGG + Intronic
954311213 3:49769191-49769213 CTGAATTTATAGATTCATTTGGG - Intronic
954846090 3:53557919-53557941 CTGAATCTATAGATCGATTTGGG + Intronic
956236446 3:67077439-67077461 GTCCAAATATAGATGGAATTTGG - Intergenic
956615474 3:71167092-71167114 CTGCATTTGTTGATCAAATTTGG - Intronic
957006556 3:74955121-74955143 TTGTATTTATAGATTGAACTGGG - Intergenic
957412527 3:79859909-79859931 GTCCATTTATTGTTGGAATTAGG - Intergenic
957720289 3:83986954-83986976 CTGCAGTAATAGATTGAATTTGG - Intergenic
959162384 3:102737795-102737817 CTGCATTCATTGATGGTTTTGGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959412463 3:106042160-106042182 CTGCATTTGTGGATGGTGTTTGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960258919 3:115542942-115542964 TTGCACTTATAGATGCATTTGGG + Intergenic
961586532 3:127932345-127932367 CTGTATATATAATTGGAATTCGG + Intronic
962015545 3:131436211-131436233 CTGGCTTTATAGAATGAATTTGG - Intergenic
962403773 3:135083095-135083117 CTGGAATTCTAGATGGTATTTGG + Intronic
963617851 3:147566084-147566106 CTGCCCTTGTAGATGGAGTTAGG - Intergenic
965348689 3:167585980-167586002 CTGGATGGATAGATGGAAGTCGG + Intronic
966143276 3:176781255-176781277 CCACATTTAAAGATGGAAGTGGG - Intergenic
966166792 3:177028672-177028694 TTGAATTTATAGGTGAAATTAGG - Intronic
969553558 4:7889945-7889967 TTGCATCTATAGATGGATTTGGG - Intronic
971373891 4:26040709-26040731 CTGCAATTAAAGATGAGATTTGG + Intergenic
971651064 4:29274723-29274745 CTACATTTTTAGATAGAAGTGGG - Intergenic
973186206 4:47332186-47332208 TTGCATTTATAGAAGTGATTTGG - Intronic
974848102 4:67375963-67375985 CTGCAATTCAAGATGCAATTTGG - Intergenic
974984360 4:69002275-69002297 TTGCATTTATAGATTTATTTTGG + Intergenic
976374958 4:84335547-84335569 CTGGATTTATAGAATGAGTTAGG + Intergenic
976623572 4:87154059-87154081 CTGAATTTATAGATTGCTTTTGG - Intergenic
976874143 4:89834105-89834127 ATACCTTTTTAGATGGAATTTGG - Intronic
977232856 4:94472694-94472716 CGGCATTTATAGATAAAGTTGGG + Intronic
977531625 4:98207357-98207379 CTGCATTAATGGATGTAAATTGG + Intergenic
978262487 4:106777357-106777379 CTGTATTTATAGATAAATTTGGG - Intergenic
978406757 4:108387814-108387836 CTGCATTGATTGATATAATTGGG - Intergenic
978499900 4:109398221-109398243 TTACATTTATAAATGAAATTTGG - Intergenic
979047655 4:115889214-115889236 TTGCATTTATATGTGGTATTTGG - Intergenic
979976207 4:127199113-127199135 CTGAATTTATAGATTGCTTTTGG - Intergenic
981166322 4:141562576-141562598 CTGAATTTATTGCTTGAATTCGG + Intergenic
981863196 4:149381767-149381789 ATGTATTTTTAGATGGAGTTTGG + Intergenic
982752645 4:159180475-159180497 CTGCTATTATAGATGCAGTTAGG - Intronic
982953235 4:161727617-161727639 CTGCATTTTTGCATGGAATTTGG + Intronic
983749555 4:171248934-171248956 CTGAATTTATAGATTGCTTTAGG + Intergenic
983776931 4:171619820-171619842 CAGCATTCATAGAATGAATTAGG - Intergenic
983974488 4:173916467-173916489 ATGCAATTATAAATGAAATTTGG + Intergenic
984021968 4:174496766-174496788 CTGCATTTATTGCTGAACTTTGG - Intronic
985533982 5:452787-452809 CTGCATTTATAGGAAAAATTCGG - Intronic
986190098 5:5488720-5488742 AAGCATTTATAAATGGACTTTGG - Intronic
986216045 5:5720080-5720102 CAGCATTTAAAGAGGTAATTAGG - Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
986649398 5:9948666-9948688 CTGCATGGATAGTTTGAATTTGG + Intergenic
987537937 5:19212123-19212145 CTGCACTTGTAGAATGAATTTGG - Intergenic
987562680 5:19544237-19544259 CTACTTTTATTCATGGAATTTGG - Intronic
987847918 5:23311512-23311534 CTGCAATTCAAGATGAAATTTGG + Intergenic
988320477 5:29688473-29688495 CTGCATTTAAAAATAAAATTTGG - Intergenic
988333033 5:29867607-29867629 TGGAATTTATAGATGCAATTGGG - Intergenic
988469789 5:31527290-31527312 CTGCATTTGGAGATGGGAGTGGG - Intronic
991008082 5:61851220-61851242 TTGAATTTATAGATCAAATTGGG - Intergenic
992527746 5:77628823-77628845 CTGTGTTTATTTATGGAATTCGG - Exonic
992642706 5:78781874-78781896 CTGCAATTAGACATGGAAATTGG - Exonic
992660821 5:78959027-78959049 CTACAATTAAAGATGAAATTTGG - Intronic
993033629 5:82732798-82732820 CTACATTTAAAGATGAGATTTGG + Intergenic
993363392 5:87005036-87005058 CAGCTTTTATAGCTGGCATTAGG - Intergenic
993823374 5:92649090-92649112 ATGCTATTATAAATGGAATTGGG - Intergenic
994409825 5:99392797-99392819 CTACAATTAAAGATGAAATTTGG + Intergenic
994483994 5:100372479-100372501 CTACAATTAAAGATGAAATTTGG - Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
994950623 5:106457116-106457138 TTACATTTATAGATGAATTTGGG - Intergenic
995253846 5:110023322-110023344 CTGCACTTATAGAATCAATTAGG - Intergenic
995496657 5:112752196-112752218 CAGCATTTTTAGATGAAATGAGG - Intronic
995944313 5:117624442-117624464 CTGAATTTATATATAGATTTTGG - Intergenic
995964656 5:117890152-117890174 ATGCATTTATAGATTGATTTTGG - Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
999352379 5:150886404-150886426 CTGTTTTTATAGAATGAATTGGG + Intronic
999813370 5:155150299-155150321 CTGCAGTTAGAGATGGTCTTGGG + Intergenic
1000612711 5:163392329-163392351 TTGAATCTATAGATGGTATTGGG + Intergenic
1001341102 5:170846244-170846266 GTGCATATATAAATGCAATTGGG - Intergenic
1001538518 5:172519030-172519052 TTGAATCTATAGATCGAATTGGG - Intergenic
1001787831 5:174428674-174428696 CTTCAGTAATAGATGGATTTGGG + Intergenic
1002886625 6:1302392-1302414 CTGAATCTATAGATCGCATTGGG - Intergenic
1003548773 6:7083724-7083746 CTTCATTTTAGGATGGAATTTGG + Intergenic
1004078016 6:12363161-12363183 CTGCCTTTCTCGATGGAAGTTGG - Intergenic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1004681782 6:17902861-17902883 CTACATGAATAGATGGGATTGGG - Intronic
1005228199 6:23667590-23667612 TTGAATTTATAGATCAAATTGGG + Intergenic
1005297600 6:24441810-24441832 CTGCATTTTTATTTGGAACTGGG + Intronic
1007658456 6:43467356-43467378 CTACAATTCAAGATGGAATTTGG - Intergenic
1007976917 6:46111302-46111324 CTGCATTTGTAGTTTGAATTAGG - Intergenic
1008141290 6:47835459-47835481 TTGCATTTAATGATTGAATTTGG + Intergenic
1008918491 6:56816964-56816986 CTGCATTTGTAGTTGGTTTTTGG - Intronic
1009533268 6:64847865-64847887 CAGCATTGATAGATGTAATTAGG - Intronic
1009770599 6:68139039-68139061 CTGCATTTAAAGTTGCAGTTTGG - Intergenic
1010772890 6:79852900-79852922 CTGTATTTATTGAAGAAATTGGG - Intergenic
1010882742 6:81200134-81200156 CTGCAATTCAAGATGAAATTTGG - Intergenic
1011138178 6:84122201-84122223 CTGTATTTATAGAATGAGTTTGG - Intergenic
1011359316 6:86505635-86505657 CTGGACTTATAGATTGCATTGGG + Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1014285344 6:119490803-119490825 CTGGATTCATAGAATGAATTAGG - Intergenic
1014407798 6:121072069-121072091 TTGGATTTATATATGTAATTAGG + Intergenic
1014478824 6:121909617-121909639 CTGTATTTATAAAGTGAATTTGG + Intergenic
1015152066 6:130051420-130051442 CTCAATTTATAGATGGAATGGGG - Intronic
1015262675 6:131256383-131256405 ATGAATTAATAGATGGAATCAGG - Intronic
1015556476 6:134466956-134466978 GTGCATTTATAGGAGGAGTTTGG + Intergenic
1017534971 6:155337571-155337593 CTGGCTTTATAGAACGAATTAGG + Intergenic
1018585302 6:165350647-165350669 CTGCAATTCAAGATGGGATTTGG - Intronic
1018955372 6:168406522-168406544 CTGCATTTAATGCTGGAGTTTGG - Intergenic
1019092254 6:169548254-169548276 CTGAATGTGTAGATCGAATTGGG - Intronic
1021105263 7:16631338-16631360 CTGTATTTATAAAGTGAATTGGG + Intronic
1022407707 7:30107097-30107119 CTGAATTTATAGACTGACTTTGG + Intronic
1023315606 7:38932935-38932957 CAGTATTTATACATGGAATGGGG + Intergenic
1024221328 7:47289817-47289839 TTGAATCTATAGATGAAATTAGG - Intronic
1024924147 7:54595094-54595116 CTGAATTTATAGATTAATTTGGG - Intergenic
1025170145 7:56749096-56749118 CTGCAATTGAAGATGAAATTTGG - Intergenic
1025701740 7:63826622-63826644 CTGCAATTGAAGATGAAATTTGG + Intergenic
1026171141 7:67954963-67954985 CTGCAATTCAAGATGAAATTTGG + Intergenic
1028194974 7:87895654-87895676 ATGGATTTATATAGGGAATTAGG + Intronic
1028431646 7:90754053-90754075 CTGCATCAATAGATTGCATTGGG - Intronic
1028912127 7:96220179-96220201 TTGCATTTAGAGAGTGAATTAGG - Intronic
1029862284 7:103585696-103585718 CTGGTTTTATAGATTGAGTTAGG - Intronic
1029875756 7:103749848-103749870 CTACAATTCAAGATGGAATTTGG - Intronic
1031112944 7:117633081-117633103 TTGAATCTATAGATGGAGTTGGG + Intronic
1031245524 7:119306638-119306660 CTGGCTTTATAGAGTGAATTAGG - Intergenic
1031862571 7:126997914-126997936 CTGGATTTATAGAATGAATTCGG - Intronic
1031957403 7:127956331-127956353 CTGCATTTATAGCTGGACTGTGG + Intronic
1032725532 7:134587052-134587074 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1032922276 7:136562852-136562874 CTGAATTTATAGATTGCTTTTGG + Intergenic
1032935506 7:136726439-136726461 CTGAATTTATAGATTGCTTTGGG - Intergenic
1034248969 7:149672915-149672937 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1038366946 8:26946121-26946143 CTGGCTTCATAGAAGGAATTAGG + Intergenic
1038465519 8:27759303-27759325 CTACATTTAAAGATGAATTTAGG + Intronic
1039533294 8:38284118-38284140 CTGCAGTTACAGATGAATTTTGG - Intronic
1040624183 8:49126656-49126678 GTGAATCTATAGATGGAGTTGGG + Intergenic
1041537991 8:58949563-58949585 CTGCATTTATAGAACTAGTTGGG + Intronic
1042253418 8:66778761-66778783 CTGGATTTATAGAGGGGAGTGGG + Intronic
1042673808 8:71294662-71294684 TTGAATTTATAGATCAAATTGGG - Intronic
1043425955 8:80149130-80149152 CTGCAATTCAAGATGAAATTCGG - Intronic
1043828898 8:84964092-84964114 TTGAATTTATAGATCAAATTAGG - Intergenic
1044907614 8:97021786-97021808 CTGAATTTATAGATTGCTTTTGG - Intronic
1045123947 8:99068847-99068869 CTACAATTCTAGATGAAATTTGG + Intronic
1046685649 8:117223569-117223591 CTACATTTTTACCTGGAATTTGG + Intergenic
1047884701 8:129236376-129236398 CTACAATTCAAGATGGAATTTGG - Intergenic
1048117410 8:131540197-131540219 TTGCATTTCAAGATGAAATTTGG + Intergenic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1050924241 9:11242592-11242614 CTGAATTTATAGATAGAGTTAGG + Intergenic
1051111040 9:13637036-13637058 CTGGCTTTACAGATGGAATGGGG + Intergenic
1052080304 9:24197944-24197966 CTACAATTAAAGATGAAATTTGG - Intergenic
1052405002 9:28048262-28048284 CTGTATTTATAGATTTAGTTGGG - Intronic
1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG + Intronic
1056309787 9:85328581-85328603 CTGAATTTATAGATTGCTTTTGG - Intergenic
1056731428 9:89169564-89169586 CTTCATGTCTAGAAGGAATTTGG + Intronic
1057137335 9:92702014-92702036 CTGCATTTATTGATAGGATAGGG + Intergenic
1057493098 9:95537987-95538009 CTGCTTTTCTACAGGGAATTTGG - Intergenic
1057620408 9:96629654-96629676 CTGCATTTAAAAATGGAAAGAGG - Intergenic
1058368564 9:104237141-104237163 ATGAATTTGTAGATGAAATTGGG - Intergenic
1058622890 9:106902425-106902447 CTGGATTCATAGAATGAATTAGG + Intronic
1058737940 9:107912475-107912497 CTGCATATTTAGATGTCATTTGG - Intergenic
1059577526 9:115506978-115507000 CTGAATTTATAGATTGCTTTGGG + Intergenic
1059814758 9:117900011-117900033 TAGAATCTATAGATGGAATTTGG - Intergenic
1060039566 9:120288122-120288144 CAGCATATATAAATAGAATTTGG + Intergenic
1062194905 9:135267570-135267592 CTTCAGTTACAGATGGACTTTGG + Intergenic
1187211397 X:17235887-17235909 CTTCTGTTATAGATGGAATGGGG + Intergenic
1188047606 X:25445676-25445698 GTCCATTTTTAGATGGAGTTTGG - Intergenic
1188087499 X:25918752-25918774 CTGAATTTATAGATTGCTTTGGG - Intergenic
1188359412 X:29234059-29234081 CTGCATTTATTTATGGAGCTTGG - Intronic
1190149530 X:47932573-47932595 TTGCATCTATAGATAAAATTAGG + Intronic
1190450477 X:50575137-50575159 TTGAATTTATAGATCGATTTTGG + Intergenic
1191167292 X:57404331-57404353 CTGTCTTTGTAGATGGATTTTGG + Intronic
1191222950 X:58010148-58010170 CTGCATTTATAGATCGGTTTTGG + Intergenic
1191970739 X:66813347-66813369 GTGCATATATATTTGGAATTGGG + Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1192740207 X:73885082-73885104 CTGGATTCATAGAATGAATTAGG - Intergenic
1192944059 X:75945847-75945869 CTGGATTCATAGAATGAATTAGG + Intergenic
1193172184 X:78349139-78349161 CTGTCTTTGTAGATGGATTTTGG + Intergenic
1194397694 X:93405244-93405266 CTGCAATTCAAGATGAAATTTGG + Intergenic
1195209887 X:102644370-102644392 CTGAATTTATAGATTAAATTTGG + Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1196046164 X:111258531-111258553 GAGCATTTATAGGTGGACTTAGG + Intronic
1196181531 X:112696815-112696837 CTGTACTTATAGAATGAATTTGG + Intergenic
1196261168 X:113583332-113583354 TTGAATTTATAGATAGATTTAGG - Intergenic
1197133500 X:123033533-123033555 CTGCAATTATAGTTGGGTTTTGG - Intergenic
1197145184 X:123164291-123164313 CTGGATTCATAGAAGGATTTAGG - Intergenic
1197352720 X:125398158-125398180 CTGAATTTATAAATTGAGTTAGG + Intergenic
1199491419 X:148404454-148404476 ATGTATTTATGGATGGAATGAGG + Intergenic
1199702614 X:150394510-150394532 CTGAATCTATAGATCAAATTGGG + Intronic
1200853566 Y:7911519-7911541 CTGCCATTATAGATGAAGTTTGG + Intergenic
1201790929 Y:17839875-17839897 GGGGATTTATAGTTGGAATTAGG + Intergenic
1201810625 Y:18066114-18066136 GGGGATTTATAGTTGGAATTAGG - Intergenic