ID: 947019146

View in Genome Browser
Species Human (GRCh38)
Location 2:225655072-225655094
Sequence TGGTATATGAACAAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 229}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947019140_947019146 -10 Left 947019140 2:225655059-225655081 CCACCACCAGAGGTGGTATATGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019128_947019146 27 Left 947019128 2:225655022-225655044 CCCCATTCCCCATGGGCCTGGGG 0: 1
1: 0
2: 4
3: 40
4: 302
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019130_947019146 26 Left 947019130 2:225655023-225655045 CCCATTCCCCATGGGCCTGGGGC 0: 1
1: 0
2: 3
3: 15
4: 264
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019133_947019146 19 Left 947019133 2:225655030-225655052 CCCATGGGCCTGGGGCCAATAGT 0: 1
1: 0
2: 0
3: 2
4: 78
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019131_947019146 25 Left 947019131 2:225655024-225655046 CCATTCCCCATGGGCCTGGGGCC 0: 1
1: 0
2: 3
3: 43
4: 370
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019134_947019146 18 Left 947019134 2:225655031-225655053 CCATGGGCCTGGGGCCAATAGTG 0: 1
1: 0
2: 0
3: 7
4: 150
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019139_947019146 -9 Left 947019139 2:225655058-225655080 CCCACCACCAGAGGTGGTATATG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019136_947019146 4 Left 947019136 2:225655045-225655067 CCAATAGTGACAGCCCACCACCA 0: 1
1: 0
2: 2
3: 7
4: 112
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019132_947019146 20 Left 947019132 2:225655029-225655051 CCCCATGGGCCTGGGGCCAATAG 0: 1
1: 0
2: 0
3: 5
4: 117
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229
947019135_947019146 11 Left 947019135 2:225655038-225655060 CCTGGGGCCAATAGTGACAGCCC 0: 1
1: 0
2: 1
3: 5
4: 113
Right 947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947019146 Original CRISPR TGGTATATGAACAAAGGGGA AGG Intergenic
900685174 1:3943727-3943749 TGGAAAATGAAGAAAGGAGAGGG - Intergenic
901017481 1:6240305-6240327 TCATATATGCACAAAGGGGCCGG + Intergenic
904907670 1:33910218-33910240 TGGCTTATGAACAAGGGGCAGGG + Intronic
906357457 1:45119273-45119295 TGGAATAAGAACAAGGGGGTTGG - Intronic
907461854 1:54609862-54609884 TGGAGTATGAACAATGGGCACGG + Exonic
907638153 1:56157301-56157323 TGGTGTATTAGAAAAGGGGAGGG - Intergenic
908832728 1:68195920-68195942 TGATAAATCAACAAAAGGGAGGG - Intronic
909160407 1:72141104-72141126 TGGTATATGAGAAAAGGGAAAGG + Intronic
910217384 1:84855914-84855936 TGGCATTTGAACAAGTGGGATGG + Intronic
910828692 1:91437267-91437289 TGGTATAAGAAGAATGGGTAGGG - Intergenic
912375370 1:109205283-109205305 TGGTAGATATAGAAAGGGGATGG + Intronic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913440242 1:118889366-118889388 TTGTAAATGATCAAAGAGGATGG - Intronic
914857041 1:151360164-151360186 TAGAAAATGAACAAAAGGGATGG - Intergenic
916705830 1:167348914-167348936 TGGTATCTAAAAAAAGTGGAAGG - Intronic
918835822 1:189464303-189464325 AGGTATGTGAACAAGGGTGATGG - Intergenic
919714095 1:200756892-200756914 TAATATATGACCAAAGGGCAAGG - Intronic
923469149 1:234274951-234274973 TGGTATATGAAGAAAGAAGTAGG - Intronic
923729768 1:236538986-236539008 TGATAAATGAAAAATGGGGACGG + Exonic
923789491 1:237099933-237099955 TGGGATATGAACCCAGCGGAGGG + Intronic
1063987423 10:11520182-11520204 GAGTATATGAAGAAAAGGGACGG + Intronic
1064700955 10:18021142-18021164 TTGTATATGGTGAAAGGGGAGGG + Intronic
1066485384 10:35838116-35838138 TGGTAGGGGAAGAAAGGGGATGG - Intergenic
1070948326 10:80411106-80411128 TGGTATATGAAGACAAGGGTGGG + Intronic
1071296884 10:84227519-84227541 TGGCATATGAACAGAGGGAGTGG + Intergenic
1072497893 10:95980743-95980765 AGAAATATGAACAAATGGGAAGG + Intronic
1073619762 10:105034836-105034858 AATTATATGAACAAGGGGGAGGG - Intronic
1075681795 10:124338643-124338665 TGTTGTATGAACTAGGGGGAGGG + Intergenic
1075812737 10:125237495-125237517 TGGTATATGAAAAATGGAGAAGG - Intergenic
1077346630 11:2061123-2061145 TGGGATATGAAAAATGGAGAAGG - Intergenic
1077963218 11:7097553-7097575 TGCTATATAAATAAAGGTGAAGG + Intergenic
1078534286 11:12160722-12160744 TGGAATATGAACCAAGGGCATGG - Intronic
1078854393 11:15195076-15195098 TGGTGTTGGAGCAAAGGGGATGG + Intronic
1079069719 11:17333576-17333598 TCCTGTAAGAACAAAGGGGATGG - Intronic
1080814056 11:35736860-35736882 TGTTAAATGAACAAAAGGAAGGG - Intronic
1081173818 11:39901488-39901510 GGGCATATGAAAAAAGAGGAAGG - Intergenic
1081639815 11:44745098-44745120 TGCTATATGACCTAAGGTGAGGG + Intronic
1083562249 11:63681917-63681939 TGGAAAATGGGCAAAGGGGAAGG + Intronic
1084994650 11:72964449-72964471 TGGTAGTAGCACAAAGGGGAAGG - Intronic
1085485407 11:76859623-76859645 TAGGATGTGAACAAAGGGCAAGG + Intergenic
1085524477 11:77156465-77156487 TTGTATCTGAACGAAGGTGAAGG + Intronic
1085693895 11:78687817-78687839 TGTTATCAGAACAAAGGGTAGGG - Intronic
1087106899 11:94418643-94418665 TAGTATTTGAACAAAGCAGAAGG - Exonic
1088365350 11:109034519-109034541 TGGGATATGATCAGAGGGGAAGG + Intergenic
1088620891 11:111682330-111682352 TGGCATAGGAAAAAGGGGGAGGG + Intronic
1088813865 11:113408755-113408777 TGGTATGTGTGCAATGGGGATGG + Intergenic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089721822 11:120432019-120432041 TGGTACATTAAAAATGGGGATGG - Intronic
1090518798 11:127457234-127457256 GGCTATTTGAGCAAAGGGGATGG - Intergenic
1090908713 11:131099406-131099428 TGGTAGAGGAAGAAAGGTGAGGG + Intergenic
1091073816 11:132595179-132595201 TGGTACATCAGGAAAGGGGAGGG + Intronic
1091895473 12:4099660-4099682 TGGAATATAAGCACAGGGGAAGG + Intergenic
1093109563 12:15133004-15133026 TGGGATATGAATAATGGGGGAGG - Intronic
1093381286 12:18497005-18497027 TTGCATATGTCCAAAGGGGAAGG - Intronic
1093816250 12:23551702-23551724 TGAGATATGAACTCAGGGGATGG + Intronic
1094702362 12:32882008-32882030 GGGAATATGCAGAAAGGGGAAGG + Intronic
1095259034 12:40077324-40077346 TTGTATATGAAGAAAGGAAAGGG + Intronic
1096133005 12:49175426-49175448 TTGTACATGAACCAAGTGGATGG - Intergenic
1099160504 12:79235523-79235545 TGGTATATTTACAAAGCAGAAGG - Intronic
1100978428 12:100145496-100145518 TGCTATAAGAACACAGAGGAAGG + Intergenic
1101560905 12:105857167-105857189 TGGTAGATGAATGATGGGGATGG + Intergenic
1101735310 12:107458856-107458878 TGGCAGATGAATAAAGGAGAAGG - Intronic
1106966559 13:35078059-35078081 TGCTTTATAAATAAAGGGGAAGG + Intronic
1106978341 13:35248758-35248780 TGGTATATGGAGAAAGGTAAGGG - Intronic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1111352900 13:87055049-87055071 TGATATATGTAAAAAAGGGATGG + Intergenic
1111585706 13:90281566-90281588 GGGTAAATCAACAAAGGGAAGGG + Intergenic
1112706723 13:102078617-102078639 TGGAAGATGAACAGAGGGGTAGG + Intronic
1115202297 14:30867993-30868015 TGGTAAATAAACAAGGGAGAAGG + Intergenic
1115233452 14:31186121-31186143 TGGTGTATGAACTAAGAGAATGG - Intronic
1115515396 14:34180165-34180187 TAGAATATAAACAAAGGGAAAGG + Intronic
1116024463 14:39498116-39498138 AGGTAAATGAATAATGGGGATGG - Intergenic
1116266926 14:42704132-42704154 TGGCATATGAGCAAAGGTGAGGG + Intergenic
1117077173 14:52116373-52116395 GGGTTATTGAACAAAGGGGAGGG - Intergenic
1117455747 14:55895150-55895172 TGGCATCTGCACAAACGGGATGG + Intergenic
1119240008 14:73051538-73051560 TGGAACATGAGCACAGGGGAAGG - Intergenic
1121081092 14:91108974-91108996 TGGTATAGGAACAGGGGGTATGG + Intronic
1127822126 15:62667457-62667479 GGGTAGAGGAACAGAGGGGAGGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129106346 15:73310132-73310154 TGGTAGATGAAAAAAGAGGTTGG + Intergenic
1129886370 15:79040599-79040621 AGCTATGTGAACAAAGGGGGTGG - Intronic
1129922750 15:79334266-79334288 TGATATTTGAACTAAAGGGAAGG + Intronic
1130545539 15:84855579-84855601 TGGTATAACAACAAAGAGCATGG + Intronic
1133266439 16:4587209-4587231 TTCAATATGAACAAAGGGGGAGG - Intronic
1135650495 16:24202146-24202168 AGGTTTATGCACAAAGGAGAAGG - Intronic
1138703963 16:58894869-58894891 TCATATATGAACACAGGGAAAGG + Intergenic
1139692894 16:68652335-68652357 TGGCATATGAGGAAATGGGAAGG - Intronic
1140445186 16:75021336-75021358 GGGTATAAAAGCAAAGGGGAAGG - Intronic
1140846245 16:78891163-78891185 GGGTATATGAAAGAAGGGGCAGG - Intronic
1141032535 16:80602292-80602314 TCCTACATGGACAAAGGGGAGGG + Exonic
1143432973 17:6900397-6900419 TGGAATCTGAATAAAGGGGCAGG - Intronic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1145339879 17:21945021-21945043 TGGAATATAAACAAATGGAAAGG + Intergenic
1150379770 17:64711399-64711421 TGGTGAATGACCAAAGAGGATGG + Intergenic
1150776947 17:68088744-68088766 TGGTGAATGACCAAAGAGGATGG - Intergenic
1151800351 17:76375836-76375858 TGGATAATGAACACAGGGGAGGG + Intronic
1155160822 18:23194093-23194115 TGCTGTATCAACGAAGGGGAAGG - Intronic
1155273157 18:24160361-24160383 TGGTAGATGCGAAAAGGGGATGG + Intronic
1159881202 18:73859987-73860009 TTGAATATGAAAAAAGGAGATGG + Intergenic
1161941357 19:7406517-7406539 TGGTATCTGAATGCAGGGGAAGG - Intronic
1164545175 19:29154656-29154678 TTAGATATGAACTAAGGGGATGG - Intergenic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
925555177 2:5122885-5122907 TGTGATAAGAACAAAGGGTAAGG + Intergenic
927955679 2:27205846-27205868 TGGTATATGAAGGTAGAGGATGG - Intronic
928694059 2:33830712-33830734 TGTTAGCTCAACAAAGGGGATGG + Intergenic
929542667 2:42834273-42834295 AGGTCTGTGCACAAAGGGGAGGG + Intergenic
931738129 2:65216743-65216765 TGGTATCTGAACAGAGAGGCTGG - Intergenic
934017433 2:87903431-87903453 TGGTATATATACAAAGTGGGGGG - Intergenic
934192828 2:89815300-89815322 TGGAATATGATCAAATGGAATGG - Intergenic
934219063 2:90064869-90064891 TGGTGTATTAACACAGGGGTGGG + Intergenic
936746679 2:115584798-115584820 TGGTACATAAACAAAAGTGATGG + Intronic
937630296 2:124094123-124094145 TGGTGTGTGAATAAAGGGGATGG + Intronic
938947112 2:136223379-136223401 AGGCAAATGAACTAAGGGGATGG - Intergenic
939613990 2:144342115-144342137 TGGTCTATGAATTAAGGGAAAGG - Intergenic
939858281 2:147387401-147387423 TGTTATAGGTACAAAGGGAAAGG - Intergenic
942339832 2:174932295-174932317 TGGTATATCTACAAAATGGAGGG - Intronic
943955506 2:194183990-194184012 TGGCATTTGAACAAAGTGCAGGG - Intergenic
944962053 2:204886241-204886263 TGGTTTATGGAGAAATGGGAGGG - Intronic
945263705 2:207869382-207869404 TGGTATATGGAGAAAGGGAAAGG - Intronic
946461638 2:219873927-219873949 TGGTTGATGGACATAGGGGAAGG + Intergenic
947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG + Intergenic
947347088 2:229203278-229203300 AGTTATATCTACAAAGGGGATGG + Intronic
1170182824 20:13552211-13552233 TGGTTTGTGAACCAAGGAGATGG - Intronic
1170277620 20:14609357-14609379 TGGGATCTGAACAAATGGGAAGG + Intronic
1170740144 20:19048966-19048988 AGGAATATGAAGAAAAGGGAGGG + Intergenic
1171213019 20:23331446-23331468 TGTAATATGCACTAAGGGGAGGG + Intergenic
1172020511 20:31910539-31910561 TAGTATTTGAACAAGGGGGTAGG - Intronic
1172311916 20:33925071-33925093 TGGCATATGAACAGAAGGGATGG - Intergenic
1177081975 21:16651024-16651046 AGGTTTATTGACAAAGGGGAAGG + Intergenic
1178537787 21:33424622-33424644 TGGGATATGAACCCAGGTGAGGG - Intronic
1178675078 21:34623845-34623867 TGGTACATGAACAGAGAGGCGGG + Intergenic
1179398603 21:41063399-41063421 TGTTATTTGAAGAAAGGGAAGGG + Intergenic
1182148126 22:28009994-28010016 AGGTATTTGAACACAGGGGAAGG - Intronic
1184870600 22:47235585-47235607 TGATCTGTGAACACAGGGGATGG + Intergenic
1185169092 22:49281936-49281958 TAGCATATGAACAAAGGTGGTGG + Intergenic
949110520 3:254982-255004 TGGTATCTGAGGAAAGGGTAGGG - Intronic
949136870 3:577820-577842 TGGAATATGGACAAAAGGAAAGG + Intergenic
950458711 3:13108161-13108183 TGGTCAGTGAACAAAGTGGAAGG - Intergenic
951481317 3:23165130-23165152 TGGTATTTGAAGGATGGGGATGG + Intergenic
952126583 3:30307603-30307625 TGGTGTAAGAACAAAGTTGAAGG + Intergenic
952889608 3:38031246-38031268 TGGTACATAGACAAAGGGAAAGG - Intergenic
954533141 3:51338042-51338064 GGGTATATGAATTAAGTGGAAGG - Intronic
956328090 3:68075331-68075353 TAGAAAAGGAACAAAGGGGAAGG - Intronic
956721485 3:72121775-72121797 TGGTCTATGAAGAAAGGGCCAGG - Intergenic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
958467564 3:94476478-94476500 TGGTAAAAGAACAAAGCGGGAGG + Intergenic
958903681 3:99918270-99918292 TGGTATATAAAACAAGGGGCTGG - Intronic
959378096 3:105609501-105609523 TGGTATATGACCAAACAGCAGGG + Intergenic
959629482 3:108491904-108491926 TGGGATATGAAGAATGGGAAGGG - Intronic
960127842 3:114019858-114019880 TGTTATAGGAACACAGTGGATGG - Intronic
962035948 3:131651696-131651718 TGTTGTATGGACAGAGGGGATGG + Intronic
962502688 3:136011026-136011048 TGGTATATTTAGAAAGAGGAGGG - Intronic
963577709 3:147082752-147082774 TGATATAAAAACAAAGGGGGAGG + Intergenic
964703334 3:159592697-159592719 TGTTATATGAACAAAGTAGAGGG - Intronic
965315596 3:167186277-167186299 TTGTCTATGTACAAAGGGCATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
971814470 4:31468437-31468459 TGGTATGTGCTCAAAGGTGATGG + Intergenic
972346908 4:38199965-38199987 TGGTATATGGAAAGAAGGGATGG - Intergenic
972903776 4:43718924-43718946 TACTATATGACCCAAGGGGAGGG - Intergenic
974869138 4:67617389-67617411 TGGGATATGCACAATGGGAAAGG + Exonic
975757684 4:77587275-77587297 AAGTGAATGAACAAAGGGGATGG - Intronic
977311354 4:95391695-95391717 TGGTATTTGAACAAAGTTAAGGG - Intronic
978243914 4:106549316-106549338 GGGTAGATGTACACAGGGGAGGG + Intergenic
979587174 4:122434046-122434068 TGGTATATGCAGAAGTGGGAGGG - Intergenic
979600290 4:122580191-122580213 TGGCAGATGAAGAAAGAGGAAGG + Intergenic
979947571 4:126852516-126852538 TGGTATATGAACAAATGTAAAGG - Intergenic
981337947 4:143588026-143588048 TGGTGGATGAACAAAAGAGAGGG - Intronic
982216385 4:153086010-153086032 TGTTAGATGAAGGAAGGGGAAGG + Intergenic
983658738 4:170110414-170110436 TGGTTTAGGAACAAAAGGAAAGG - Intergenic
983932331 4:173466043-173466065 TGGTCTTTAAACCAAGGGGAAGG - Intergenic
984369679 4:178846739-178846761 TGGTTCATGAGCAAAGGGAAGGG + Intergenic
984852429 4:184165662-184165684 AGGGATATCAACAAAGGAGATGG + Intronic
986665969 5:10104459-10104481 TGGTGTAGGAACAAATGGTAAGG - Intergenic
986752429 5:10800872-10800894 TGGTATATTCACAAAAGGCAGGG + Intergenic
987210917 5:15682282-15682304 TGGAATGTGAACAGAGGTGAGGG - Intronic
989242012 5:39212507-39212529 TGGAATGGGAACAAGGGGGAGGG - Intronic
989734998 5:44693512-44693534 TGGGAAATGAGAAAAGGGGAGGG - Intergenic
992839891 5:80678087-80678109 TAGTATATGAACATAGGGATTGG + Intronic
993423814 5:87737052-87737074 TGCCATCTGAAGAAAGGGGATGG - Intergenic
993886430 5:93420708-93420730 TGAGACATGAACAAAAGGGAAGG + Intergenic
995455562 5:112348248-112348270 TGGTAAATGGACAAAGGTGGAGG - Intronic
996206129 5:120738493-120738515 TATTAAATGAACAAAGTGGAAGG - Intergenic
996983601 5:129531707-129531729 ATGTATATGAACAAATTGGATGG + Intronic
999041319 5:148416311-148416333 TAGTATATAAACAAAAGGTAAGG + Intronic
999483302 5:151968795-151968817 TGGTATATGTACATAGGCAATGG - Intergenic
999609625 5:153354792-153354814 AGGCATAGAAACAAAGGGGAAGG - Intergenic
999643099 5:153691389-153691411 TGCTATAGGAACAATGGTGATGG - Intronic
1000543038 5:162564937-162564959 TGTTATATGAACATAGCAGATGG - Intergenic
1003133928 6:3418528-3418550 TGGAAAATGAACACAGTGGAGGG + Intronic
1003260034 6:4508738-4508760 TGGTATTTGAACCCACGGGAAGG - Intergenic
1003876382 6:10441335-10441357 TGGAATGTGATCACAGGGGAGGG + Intergenic
1004111344 6:12721758-12721780 TGGAATCTGTGCAAAGGGGAGGG - Intronic
1004323214 6:14649310-14649332 TGACATATGAACAAAAAGGAAGG - Intergenic
1004428277 6:15521356-15521378 AGGCATATGTACAAAAGGGATGG - Exonic
1006942880 6:37764691-37764713 TGGAGTTTGGACAAAGGGGAAGG - Intergenic
1007546133 6:42696039-42696061 TGGTAGGTGACCAAAAGGGATGG + Intergenic
1008377225 6:50806085-50806107 TGGTCTATGAACCAATGTGAAGG - Intergenic
1008813807 6:55539090-55539112 TGCTATATGGACAAAGAGGCAGG + Intronic
1008927847 6:56906072-56906094 GGCTATATGTACAAAGGGGTTGG - Intronic
1010103595 6:72141228-72141250 TGGTCTATGAATATATGGGAGGG + Intronic
1010332576 6:74641540-74641562 TAGTATAGGAACAATGGGCAAGG - Intergenic
1011728627 6:90236586-90236608 TGGAAGATGAACCAAGGGGCTGG + Intronic
1012546727 6:100427763-100427785 TGGTATAGGAACTCAGAGGAAGG - Intronic
1015099838 6:129463970-129463992 TGGTATTTGGGCAAAGGGGCGGG - Intronic
1016866903 6:148776688-148776710 TGGTTAAAGAAAAAAGGGGAGGG - Intronic
1020797274 7:12691423-12691445 TGGTTTATCAACAGAGGGAAAGG + Intergenic
1021266016 7:18523697-18523719 TGTTAGATGAACAAAAGGTAGGG + Intronic
1023652102 7:42382204-42382226 TGAAATGTGAACAAAGGAGATGG - Intergenic
1025104422 7:56159376-56159398 TGGTATTTGAACACAAGCGAGGG + Intergenic
1028850992 7:95537383-95537405 TGGTATACAAGGAAAGGGGAGGG - Intronic
1029472254 7:100762028-100762050 TGGACAATGAACAGAGGGGAAGG + Intronic
1034142656 7:148836705-148836727 TGGTTTAAAAAAAAAGGGGATGG + Intronic
1034340277 7:150348453-150348475 TGGTAAATGAGCAAAAGGAAAGG - Intergenic
1036038757 8:5050211-5050233 TGGTATCGTATCAAAGGGGAAGG + Intergenic
1037247541 8:16853278-16853300 TGATAAATCAACAAAGGAGATGG + Intergenic
1039583844 8:38688752-38688774 AGGTATGAGAACAAAGGGGTGGG - Intergenic
1042730905 8:71933942-71933964 TGGTATAAGAAGAAGGGGAAGGG - Intronic
1042986412 8:74588640-74588662 GAGTAAATGAACAAAGGGGTAGG + Intergenic
1044153589 8:88814781-88814803 TGTAAAATGAACAATGGGGAAGG + Intergenic
1046053490 8:109051957-109051979 GGGAAAATGAACAAAGGGAAAGG + Intergenic
1046707552 8:117472267-117472289 TTATATATGAACAAAGTGCAAGG + Intergenic
1048422638 8:134292457-134292479 TGATATATGGAAAAAGGGGAAGG + Intergenic
1049684090 8:143932320-143932342 TGGTCTCTGACCATAGGGGACGG + Intronic
1052200395 9:25771683-25771705 TGAAATATGAACAGAAGGGATGG - Intergenic
1057710910 9:97443179-97443201 TAGTATATGAGCAAATGGGATGG - Intronic
1058774817 9:108272869-108272891 TGGAATCTGAACAAATGGGTTGG - Intergenic
1059029245 9:110672437-110672459 TGCTATGTGAACATAGGGTAGGG + Intronic
1060195852 9:121622858-121622880 GGGTATATGGGCAAGGGGGATGG + Intronic
1060289570 9:122288670-122288692 TGGGATATGAAGAAAATGGAAGG + Intronic
1185950449 X:4426701-4426723 TGATATATCAACAGATGGGATGG + Intergenic
1186569445 X:10698824-10698846 TGGTACAAGAAAAAAGGAGAGGG - Intronic
1187416944 X:19101822-19101844 TGGTACAGGTTCAAAGGGGATGG + Intronic
1187765954 X:22642317-22642339 AGGTAGAGGAACAATGGGGATGG - Intergenic
1189695874 X:43661398-43661420 TTGAATATGAACAAAGTGCAGGG + Intronic
1190843138 X:54165325-54165347 TGGCATATAAATAAAGGGAAGGG - Intronic
1190916743 X:54816772-54816794 TGGAATAAGAACACAGGGGCCGG + Intergenic
1193194125 X:78609840-78609862 TGGTAAAAGAGAAAAGGGGAAGG + Intergenic
1193295024 X:79823688-79823710 TTGTGTTTGAACAAAGGAGAAGG + Intergenic
1194090660 X:89579649-89579671 AGGTTTCTGGACAAAGGGGAGGG + Intergenic
1195202716 X:102565498-102565520 GGGGATTTGGACAAAGGGGAGGG + Intergenic
1195710575 X:107770447-107770469 TAATATAGTAACAAAGGGGAAGG - Intronic
1197887999 X:131238209-131238231 AGGAATAGGAATAAAGGGGAGGG - Intergenic
1199127050 X:144135114-144135136 TGGTATATATACAAAGTGGGGGG + Intergenic
1200443312 Y:3235709-3235731 AGGTTTCTGGACAAAGGGGAGGG + Intergenic