ID: 947019236

View in Genome Browser
Species Human (GRCh38)
Location 2:225656326-225656348
Sequence ACAGCTATTAAGTATACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947019236_947019242 21 Left 947019236 2:225656326-225656348 CCTTCTGTATACTTAATAGCTGT 0: 1
1: 0
2: 2
3: 16
4: 168
Right 947019242 2:225656370-225656392 TTCCTTTCAACTTGTCTCTTCGG 0: 1
1: 0
2: 0
3: 37
4: 509
947019236_947019243 22 Left 947019236 2:225656326-225656348 CCTTCTGTATACTTAATAGCTGT 0: 1
1: 0
2: 2
3: 16
4: 168
Right 947019243 2:225656371-225656393 TCCTTTCAACTTGTCTCTTCGGG 0: 1
1: 0
2: 1
3: 19
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947019236 Original CRISPR ACAGCTATTAAGTATACAGA AGG (reversed) Intergenic
901347937 1:8563945-8563967 ACACTAATTAAGCATACAGAGGG + Intronic
904661703 1:32090386-32090408 ACAGCTCTTTAGTTTGCAGAGGG - Intronic
909866409 1:80678163-80678185 ACACCTACTAAGCATACAGGAGG - Intergenic
910320169 1:85934730-85934752 ACAGATAATAAGTAAACAAATGG - Intronic
911152524 1:94609084-94609106 ATAGCTATTAAGAAACCAGAGGG - Intergenic
917906865 1:179593391-179593413 ACAGATACTAAGGATAAAGAAGG + Intronic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
921734706 1:218613764-218613786 ACAGCAAATAAGTATAGAGGAGG - Intergenic
922922512 1:229318521-229318543 TCAGCCATTAATTATACAGATGG + Intergenic
923912866 1:238468832-238468854 ACAGATATAAAGAAAACAGAGGG - Intergenic
924550321 1:245070057-245070079 AAACCAATAAAGTATACAGAAGG + Intronic
1062815456 10:496578-496600 ACAGATTTTAAGTACACAGGAGG - Intronic
1063000948 10:1921914-1921936 ACAGCTATGAATTATATTGATGG + Intergenic
1068938658 10:62659580-62659602 ACAAATATTAAGTGTGCAGATGG - Intronic
1070400943 10:76053062-76053084 ACAGCTACTAATAACACAGAAGG - Intronic
1070692431 10:78537058-78537080 ACAGCTACCCAGTATACTGAAGG + Intergenic
1079274799 11:19025210-19025232 GCAGCTATCAAGAATTCAGAGGG - Intergenic
1083363372 11:62126779-62126801 AGAGATATAAAGTATACAGGAGG - Intronic
1086205572 11:84254428-84254450 ACAGCACTTGGGTATACAGAAGG + Intronic
1086310500 11:85530854-85530876 ATAGCTATGTAATATACAGAGGG - Intronic
1087193673 11:95283256-95283278 ATAGCTACTAAGTAACCAGAAGG + Intergenic
1087533274 11:99410791-99410813 ACAGCTATAATGAACACAGAGGG - Intronic
1088329172 11:108632522-108632544 ACAGCCAGTAACCATACAGATGG - Intergenic
1088653106 11:111975911-111975933 ACAGCTATTAAATGTAAAAAAGG - Exonic
1088870006 11:113882687-113882709 ACAGTTAATGAGTATACACAGGG + Intergenic
1090962417 11:131568855-131568877 GGAGCTATTAAGTATACAGCTGG - Intronic
1094254349 12:28404747-28404769 AAAGTTATTAAGGATAAAGAAGG - Intronic
1094685762 12:32712745-32712767 ACATATATATAGTATACAGATGG - Intronic
1097618624 12:61913425-61913447 ACAGCTTTTAATAACACAGAAGG + Intronic
1098212031 12:68176510-68176532 ACAGCTTTTAGGAAAACAGAGGG - Intergenic
1098523302 12:71458204-71458226 AAAGCAATTAAGTTTACAGTAGG - Intronic
1099149152 12:79087261-79087283 ACAGCTATTAAAAAAGCAGAAGG + Intronic
1099346501 12:81506836-81506858 ACAGATAATATGTATACAGCAGG + Intronic
1099367543 12:81787124-81787146 ACACATATTAAGAATAAAGATGG - Intergenic
1100208907 12:92380891-92380913 ACAGAGATTAAGAATACAGATGG - Intergenic
1108252710 13:48582932-48582954 ACAGCTGGGAAGTATAGAGATGG - Intergenic
1110052844 13:70925176-70925198 ACAGATATTCTGTATACTGAGGG + Intergenic
1110352403 13:74524191-74524213 ACAACTAGTAAATATACACACGG - Intergenic
1110796921 13:79649628-79649650 ACAGCTGTTTAGTAAACAAATGG + Intergenic
1111046255 13:82816747-82816769 ACAGATGCTAAGTATACATATGG + Intergenic
1112117237 13:96369414-96369436 ACAGCTGTTAAGAATACCTAAGG - Intronic
1114312771 14:21482869-21482891 ACAATTATCAAGAATACAGAAGG - Intronic
1115729320 14:36251170-36251192 ACAGCTCTTAAGTATACTGCTGG - Intergenic
1116017881 14:39428993-39429015 ACAACTAATAAGGATAAAGAAGG - Intronic
1116944215 14:50821132-50821154 ATAGCTATTAATTATAAATAAGG + Intronic
1118651200 14:67896968-67896990 ACAGGTATCAAGAATACACAAGG + Intronic
1121201145 14:92119427-92119449 ATAGCTATTAAGTACAGAGCTGG + Intronic
1122763556 14:104048810-104048832 ACAGCAATGAAGGAAACAGATGG - Intronic
1123487264 15:20752990-20753012 ACAGCAATTAATGACACAGATGG + Intergenic
1123543755 15:21322045-21322067 ACAGCAATTAATGACACAGATGG + Intergenic
1125649881 15:41307868-41307890 CCAGCTATTCAGGATACAGTTGG + Intergenic
1126995672 15:54441038-54441060 ACAAATATTCAGTATATAGAAGG - Intronic
1131231517 15:90663437-90663459 ACAGCTATTACCTATTCTGAGGG + Intergenic
1202952071 15_KI270727v1_random:49171-49193 ACAGCAATTAATGACACAGATGG + Intergenic
1133664469 16:7952540-7952562 ACAGATATAAGGTATATAGAAGG - Intergenic
1135930669 16:26733548-26733570 ATAGCTATAAAGTTTACAGCAGG + Intergenic
1137985273 16:53102054-53102076 AGGGCTATTAAGTTTCCAGAAGG + Intronic
1140746974 16:77989083-77989105 CCAGCTAGTAACTATACAGCTGG - Intergenic
1146214363 17:30967357-30967379 ATAGCTATTAATAAGACAGATGG - Intergenic
1147011824 17:37455827-37455849 ACAGCTGTTAAGTACACAGCAGG - Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1148200451 17:45746696-45746718 ACAGTCATTCATTATACAGATGG + Intergenic
1149211286 17:54304473-54304495 ACATTTATTAACTATCCAGATGG - Intergenic
1150509511 17:65735616-65735638 AAAGCAATAAAATATACAGATGG - Intronic
1151333752 17:73427387-73427409 ACAGGCACTAAGTAAACAGATGG - Intronic
1155827810 18:30470338-30470360 ACAGCTGTTTAGTATCCACAGGG - Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156574549 18:38299628-38299650 ACAGCTAATAAGCAAGCAGAGGG - Intergenic
1156868712 18:41918439-41918461 ACAGCTTATAAGAATACAGGGGG + Intergenic
1157743253 18:50112330-50112352 ACTGCTATTAAGGATAAATATGG + Intronic
1158164691 18:54527148-54527170 TCAGCAATTTAGTATACTGAGGG - Intergenic
1158334459 18:56400542-56400564 ACAGATATTAAAAAGACAGATGG + Intergenic
1158364818 18:56721874-56721896 ACATCTAATAATTATACATAAGG - Intronic
1159332181 18:67010290-67010312 ATAGTTATTAAGGATACACAAGG - Intergenic
1168330607 19:55565698-55565720 ACAGTTCTTAAGAATACAGCCGG - Intergenic
1168598393 19:57697473-57697495 AAAGCTATTAAATATACATTTGG + Exonic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
928701919 2:33907235-33907257 ACAGTTATTAATTATAAACACGG - Intergenic
930055290 2:47247277-47247299 GCAGATATTAGGTATACAAAGGG - Intergenic
930419994 2:51139006-51139028 ACAGCTATTAACTCTCCACATGG - Intergenic
931283403 2:60813140-60813162 ACAGCTAATAAGTAGACAAGTGG + Intergenic
936811104 2:116403438-116403460 ACAACTAACAAGTATAAAGAGGG - Intergenic
937467785 2:122149858-122149880 ACAGCTATTCAGTATTTACATGG - Intergenic
937497434 2:122436409-122436431 ACAGTTAATAACTAAACAGATGG + Intergenic
938742456 2:134245668-134245690 ACAGGTATAAAGAAGACAGATGG - Intronic
938861801 2:135377106-135377128 TCAGCAATTAAGTAAACAGATGG + Intronic
938889241 2:135686162-135686184 AAAGCTATTAAGTATTGATAAGG + Intronic
943438013 2:187891479-187891501 ACATTTATTAAGTGAACAGAGGG + Intergenic
944748321 2:202681427-202681449 ACAGGTTTAAAGTATAAAGATGG + Intronic
946477226 2:220018793-220018815 ACAGGTAATAAGTATAAAAATGG + Intergenic
947010173 2:225557165-225557187 GTGGCTATTAAGTAGACAGATGG - Intronic
947019236 2:225656326-225656348 ACAGCTATTAAGTATACAGAAGG - Intergenic
948515238 2:238499380-238499402 ACAGCTATCACGTTTACAGCAGG - Intergenic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1175235798 20:57510254-57510276 AGAGCTTTTATGTATACAGGTGG + Intronic
1177646788 21:23908975-23908997 ACAGCTATTGATTATAAAAATGG + Intergenic
1178889787 21:36511329-36511351 ACAGCTATTATGGGTTCAGAAGG - Intronic
1181289485 22:21780614-21780636 ACAGCTCTTAAATATATAAAAGG - Intronic
953936052 3:47044003-47044025 TCAGCTTTTAAGAATACAAATGG + Intronic
956132366 3:66066428-66066450 TGGGCTATTAAGTATTCAGAGGG - Intergenic
956944471 3:74203986-74204008 GCAGCTTTTAAGTATTAAGATGG + Intergenic
958593894 3:96197202-96197224 ACAGCTATTAGGGAAACAAACGG + Intergenic
958913915 3:100026354-100026376 ACAGCTATTTATTATTCAGAAGG + Intronic
960240797 3:115339644-115339666 ACAGCAACTAAGTAAACACATGG - Intergenic
960396271 3:117141574-117141596 ACAGCCATCCAGAATACAGAAGG + Intergenic
960484768 3:118238467-118238489 ACAGATATGAAATATATAGAAGG - Intergenic
961408194 3:126698309-126698331 ACAGCCACTGAGTATTCAGAGGG - Intergenic
961857348 3:129885720-129885742 AAACCTATTATGTATTCAGAGGG - Intronic
961942573 3:130653568-130653590 ACAGCTATTACATTCACAGATGG - Intronic
967774319 3:193370723-193370745 ACACCTAATAAGTACTCAGAAGG - Intronic
970122521 4:12772493-12772515 AGAGCTATAAAGAAGACAGAGGG - Intergenic
970424758 4:15935857-15935879 AGAGCTTTAAAGTATACAGAGGG + Exonic
971903803 4:32699056-32699078 AGAGCAATTAACTATACAAATGG + Intergenic
974496775 4:62639843-62639865 ATAGCTATAGAATATACAGAAGG + Intergenic
979001127 4:115221202-115221224 ACAGCTATCAATTATACACTAGG + Intergenic
979574021 4:122265263-122265285 AAAGATTTAAAGTATACAGAAGG - Intronic
980262513 4:130470041-130470063 ACACCTATTAAGAAAACAAAAGG - Intergenic
980622839 4:135331328-135331350 ACATATGTTAAGTATACAAAAGG - Intergenic
980676933 4:136097150-136097172 ACAGCTATTATGTGCACACAAGG - Intergenic
983853028 4:172606488-172606510 ATAGCTAATAAGAGTACAGAAGG + Intronic
985099631 4:186445745-186445767 ACAGCTATTAAGAAAACAAATGG + Intronic
986703885 5:10439597-10439619 ACAGCGATTAAGTAAACAATGGG - Exonic
986743402 5:10723846-10723868 AGAGCTCCTAAGGATACAGAAGG + Intronic
986943098 5:12980668-12980690 ACATATATTAAGTATATATAAGG - Intergenic
987058336 5:14217471-14217493 CCAGGTATGAAGTATACAGAAGG + Intronic
990451468 5:55934848-55934870 ACAACTATTAAGTATACATCTGG - Intergenic
991224375 5:64252625-64252647 CCAGCTGTTAAGTATACAGATGG + Intronic
992014733 5:72564195-72564217 AGAGCTATAAAGTAGACAAAGGG - Intergenic
994556331 5:101310351-101310373 ACACCTATGATGTATACATATGG + Intergenic
994910576 5:105900465-105900487 AGAGCTATATAGTATAGAGAAGG + Intergenic
997035801 5:130189949-130189971 ACAGCTAATAAGAATATGGATGG - Intergenic
997901996 5:137775218-137775240 AGAGTTGTTAAGTAAACAGATGG + Intergenic
999026730 5:148241950-148241972 ACAGATAATATGTATAGAGATGG + Intergenic
999555064 5:152731382-152731404 ATAGATATTAAGAATACATAAGG - Intergenic
1000958237 5:167568006-167568028 ATAGATTTTAAGTATACTGAAGG - Intronic
1003047012 6:2743069-2743091 ACAGCTATGCAGTATACATGTGG + Intronic
1005493386 6:26367971-26367993 ACAGATATTATTTTTACAGATGG + Exonic
1005502622 6:26443363-26443385 ACAGATATTATTTTTACAGATGG + Exonic
1007021286 6:38524224-38524246 ACAATTTTTAAGTATACAAAAGG + Intronic
1008409837 6:51163615-51163637 AAAGATATCAAGTCTACAGAAGG + Intergenic
1008551573 6:52637645-52637667 ACAGGTCTTAAATATACAGTTGG - Intergenic
1010069105 6:71722616-71722638 ACACCTATTAACTAAATAGAAGG + Intergenic
1011273858 6:85608245-85608267 ACAGCTTTTAAGTAGACACTTGG - Intronic
1012111171 6:95236408-95236430 TCAGTTATAAAGTTTACAGAAGG - Intergenic
1012863029 6:104583781-104583803 ACAGCTTTTAAATTAACAGAAGG - Intergenic
1014444263 6:121508075-121508097 CCAGCTATTGAAGATACAGAAGG - Intergenic
1014504498 6:122237998-122238020 ACAGATATTACATATACAGCAGG - Intergenic
1014988860 6:128048719-128048741 CTAGAGATTAAGTATACAGAAGG + Intronic
1016263474 6:142203924-142203946 ACACCTTTTAATTATACAGCAGG - Intronic
1019818148 7:3216599-3216621 ACAGCTATTAAGTGTAAACTGGG - Intergenic
1021062435 7:16130768-16130790 ACAGATATTCAGTCTACAGAAGG - Intronic
1024880305 7:54078087-54078109 ACCGCTAGTAACTATGCAGAAGG + Intergenic
1026434313 7:70381360-70381382 ACAGCTGTAAAGTGTACAGTTGG - Intronic
1029647605 7:101868248-101868270 ACAGGTTTTAACTCTACAGAAGG - Intronic
1030760063 7:113339208-113339230 ATATTGATTAAGTATACAGAGGG - Intergenic
1033542052 7:142366211-142366233 AAAGCTTATAAGTATGCAGAAGG + Intergenic
1036530977 8:9587092-9587114 ACAGAAATTAAGGTTACAGATGG + Intronic
1036930095 8:12947950-12947972 ACACCTCTTAAGGCTACAGATGG - Intronic
1040082349 8:43299882-43299904 GCAGTTATTAAGAATACACATGG + Intergenic
1040140769 8:43908922-43908944 TCACATATAAAGTATACAGAGGG + Intergenic
1040419932 8:47229642-47229664 AGAGCTATCAAGGATAAAGAGGG + Intergenic
1042306685 8:67340794-67340816 GCTTCTATTGAGTATACAGAAGG + Intronic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1044089426 8:87980556-87980578 AAAGCTATTAAGTTTCTAGAGGG - Intergenic
1045147053 8:99357674-99357696 ACAGCTATTAAGTACTAAAATGG - Intronic
1045229228 8:100285528-100285550 ACAGCAATTAAGTGACCAGAAGG + Intronic
1045323402 8:101098827-101098849 ACAGCTATGAAATAAACAGAGGG - Intergenic
1050255197 9:3786479-3786501 AGAGCTATTAAGGATAGAAAAGG - Intergenic
1186255757 X:7717128-7717150 ACAGATATTAAAAATACAGAGGG + Intergenic
1187993496 X:24901049-24901071 ACAGCCAGTAGGTATACAGCAGG + Intronic
1188258779 X:27997371-27997393 ACAGGTATTAAGAAAACACATGG - Intergenic
1188415773 X:29932145-29932167 ACAGGTACAAAGTATTCAGATGG - Intronic
1188608198 X:32060385-32060407 ACAGCTATTGAAAATTCAGAGGG + Intronic
1189754810 X:44260234-44260256 ACAGAAATTAAGTGTACAGTTGG - Intronic
1190202246 X:48372392-48372414 ACATATATAAAGTATACTGAAGG - Intergenic
1190208292 X:48423021-48423043 ACATATATAAAGTATACTGAAGG + Intergenic
1190395033 X:49973610-49973632 AATGATCTTAAGTATACAGATGG + Intronic
1190661419 X:52657550-52657572 ACATATATAAAGTATACTGAAGG - Intronic
1190669054 X:52722826-52722848 ACATATATAAAGTATACTGAAGG - Intergenic
1190670363 X:52735578-52735600 ACATATATAAAGTATACTGAAGG + Intergenic
1194077932 X:89419735-89419757 ATAGCTATAAAGTATATAAAGGG - Intergenic
1194572582 X:95571843-95571865 AAAGCTATCAAGGATAAAGAAGG - Intergenic
1196991962 X:121339713-121339735 ACAGCTATTAAGTGCAGAGTTGG + Intergenic
1197394539 X:125910595-125910617 AAAGCTATTAAGAATAGAGAAGG + Intergenic
1199281204 X:146002147-146002169 ACTGCAATTCATTATACAGAGGG + Intergenic
1200021607 X:153215447-153215469 ACAACTATTAATAAAACAGATGG + Intergenic
1201472493 Y:14349595-14349617 ACAGATATTAAGAATACAGAGGG + Intergenic