ID: 947019762

View in Genome Browser
Species Human (GRCh38)
Location 2:225662177-225662199
Sequence TTGGAGATTTTGCTCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947019762_947019766 -5 Left 947019762 2:225662177-225662199 CCAACCAAGAGCAAAATCTCCAA No data
Right 947019766 2:225662195-225662217 TCCAAAGTTGACATGAGGTTGGG No data
947019762_947019764 -10 Left 947019762 2:225662177-225662199 CCAACCAAGAGCAAAATCTCCAA No data
Right 947019764 2:225662190-225662212 AAATCTCCAAAGTTGACATGAGG No data
947019762_947019768 9 Left 947019762 2:225662177-225662199 CCAACCAAGAGCAAAATCTCCAA No data
Right 947019768 2:225662209-225662231 GAGGTTGGGAAAGTAACTTCTGG No data
947019762_947019765 -6 Left 947019762 2:225662177-225662199 CCAACCAAGAGCAAAATCTCCAA No data
Right 947019765 2:225662194-225662216 CTCCAAAGTTGACATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947019762 Original CRISPR TTGGAGATTTTGCTCTTGGT TGG (reversed) Intergenic
No off target data available for this crispr