ID: 947023691

View in Genome Browser
Species Human (GRCh38)
Location 2:225712694-225712716
Sequence CTATTCTTCCCTAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947023687_947023691 -3 Left 947023687 2:225712674-225712696 CCTCTCTCTCACTTGCTTCTCTA No data
Right 947023691 2:225712694-225712716 CTATTCTTCCCTAGGGAAGGAGG No data
947023686_947023691 12 Left 947023686 2:225712659-225712681 CCAATAACTTTTTGGCCTCTCTC No data
Right 947023691 2:225712694-225712716 CTATTCTTCCCTAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947023691 Original CRISPR CTATTCTTCCCTAGGGAAGG AGG Intergenic
No off target data available for this crispr