ID: 947023691 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:225712694-225712716 |
| Sequence | CTATTCTTCCCTAGGGAAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947023687_947023691 | -3 | Left | 947023687 | 2:225712674-225712696 | CCTCTCTCTCACTTGCTTCTCTA | No data | ||
| Right | 947023691 | 2:225712694-225712716 | CTATTCTTCCCTAGGGAAGGAGG | No data | ||||
| 947023686_947023691 | 12 | Left | 947023686 | 2:225712659-225712681 | CCAATAACTTTTTGGCCTCTCTC | No data | ||
| Right | 947023691 | 2:225712694-225712716 | CTATTCTTCCCTAGGGAAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947023691 | Original CRISPR | CTATTCTTCCCTAGGGAAGG AGG | Intergenic | ||
| No off target data available for this crispr | |||||