ID: 947023750

View in Genome Browser
Species Human (GRCh38)
Location 2:225713594-225713616
Sequence CAATTTCAGAGCCTGTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947023750_947023752 17 Left 947023750 2:225713594-225713616 CCAATAAACAGGCTCTGAAATTG No data
Right 947023752 2:225713634-225713656 TTACCAACCAAAAAAAGTCCAGG 0: 1531
1: 5988
2: 3192
3: 2162
4: 1700
947023750_947023755 26 Left 947023750 2:225713594-225713616 CCAATAAACAGGCTCTGAAATTG No data
Right 947023755 2:225713643-225713665 AAAAAAAGTCCAGGACCAGATGG 0: 3205
1: 6922
2: 3398
3: 2434
4: 2909

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947023750 Original CRISPR CAATTTCAGAGCCTGTTTAT TGG (reversed) Intergenic
No off target data available for this crispr