ID: 947031167

View in Genome Browser
Species Human (GRCh38)
Location 2:225797489-225797511
Sequence TTGTACCTCCAGAACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947031167_947031170 -8 Left 947031167 2:225797489-225797511 CCTTCCCTGTTCTGGAGGTACAA No data
Right 947031170 2:225797504-225797526 AGGTACAAAGTTCCAAATCCAGG No data
947031167_947031174 19 Left 947031167 2:225797489-225797511 CCTTCCCTGTTCTGGAGGTACAA No data
Right 947031174 2:225797531-225797553 TTCTCGTACAGAGGTTCTGAAGG No data
947031167_947031173 10 Left 947031167 2:225797489-225797511 CCTTCCCTGTTCTGGAGGTACAA No data
Right 947031173 2:225797522-225797544 CCAGGATTGTTCTCGTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947031167 Original CRISPR TTGTACCTCCAGAACAGGGA AGG (reversed) Intergenic
No off target data available for this crispr