ID: 947033058

View in Genome Browser
Species Human (GRCh38)
Location 2:225820150-225820172
Sequence GGGGCTCTTCCCGCTTTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947033051_947033058 30 Left 947033051 2:225820097-225820119 CCCCATGCTGTTCTCATGATATT 0: 28
1: 1653
2: 3592
3: 5281
4: 5468
Right 947033058 2:225820150-225820172 GGGGCTCTTCCCGCTTTTCTCGG No data
947033052_947033058 29 Left 947033052 2:225820098-225820120 CCCATGCTGTTCTCATGATATTG 0: 21
1: 2268
2: 5584
3: 8153
4: 8096
Right 947033058 2:225820150-225820172 GGGGCTCTTCCCGCTTTTCTCGG No data
947033053_947033058 28 Left 947033053 2:225820099-225820121 CCATGCTGTTCTCATGATATTGA 0: 40
1: 3199
2: 6126
3: 7786
4: 6643
Right 947033058 2:225820150-225820172 GGGGCTCTTCCCGCTTTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947033058 Original CRISPR GGGGCTCTTCCCGCTTTTCT CGG Intergenic
No off target data available for this crispr