ID: 947033232

View in Genome Browser
Species Human (GRCh38)
Location 2:225821895-225821917
Sequence TTGTGCAAATGGAAAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947033232_947033234 8 Left 947033232 2:225821895-225821917 CCTTTGTTTTTCCATTTGCACAA No data
Right 947033234 2:225821926-225821948 TTTATTTTACACATTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947033232 Original CRISPR TTGTGCAAATGGAAAAACAA AGG (reversed) Intergenic
No off target data available for this crispr