ID: 947033234

View in Genome Browser
Species Human (GRCh38)
Location 2:225821926-225821948
Sequence TTTATTTTACACATTTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947033233_947033234 -3 Left 947033233 2:225821906-225821928 CCATTTGCACAATTTTGAATTTT No data
Right 947033234 2:225821926-225821948 TTTATTTTACACATTTCTTCTGG No data
947033231_947033234 15 Left 947033231 2:225821888-225821910 CCAAATGCCTTTGTTTTTCCATT No data
Right 947033234 2:225821926-225821948 TTTATTTTACACATTTCTTCTGG No data
947033232_947033234 8 Left 947033232 2:225821895-225821917 CCTTTGTTTTTCCATTTGCACAA No data
Right 947033234 2:225821926-225821948 TTTATTTTACACATTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947033234 Original CRISPR TTTATTTTACACATTTCTTC TGG Intergenic
No off target data available for this crispr