ID: 947037690

View in Genome Browser
Species Human (GRCh38)
Location 2:225877992-225878014
Sequence TTCTATTGGAATGCATCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947037690_947037695 27 Left 947037690 2:225877992-225878014 CCTTAAGATGCATTCCAATAGAA No data
Right 947037695 2:225878042-225878064 GGCTATTTAATAAAGATTCTGGG No data
947037690_947037692 0 Left 947037690 2:225877992-225878014 CCTTAAGATGCATTCCAATAGAA No data
Right 947037692 2:225878015-225878037 ATCAATCATTTGCTATCTAATGG No data
947037690_947037693 6 Left 947037690 2:225877992-225878014 CCTTAAGATGCATTCCAATAGAA No data
Right 947037693 2:225878021-225878043 CATTTGCTATCTAATGGCATTGG No data
947037690_947037694 26 Left 947037690 2:225877992-225878014 CCTTAAGATGCATTCCAATAGAA No data
Right 947037694 2:225878041-225878063 TGGCTATTTAATAAAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947037690 Original CRISPR TTCTATTGGAATGCATCTTA AGG (reversed) Intergenic