ID: 947037692

View in Genome Browser
Species Human (GRCh38)
Location 2:225878015-225878037
Sequence ATCAATCATTTGCTATCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947037690_947037692 0 Left 947037690 2:225877992-225878014 CCTTAAGATGCATTCCAATAGAA No data
Right 947037692 2:225878015-225878037 ATCAATCATTTGCTATCTAATGG No data
947037689_947037692 16 Left 947037689 2:225877976-225877998 CCATTAACGAAAAGTGCCTTAAG No data
Right 947037692 2:225878015-225878037 ATCAATCATTTGCTATCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947037692 Original CRISPR ATCAATCATTTGCTATCTAA TGG Intergenic
No off target data available for this crispr