ID: 947037695

View in Genome Browser
Species Human (GRCh38)
Location 2:225878042-225878064
Sequence GGCTATTTAATAAAGATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947037691_947037695 13 Left 947037691 2:225878006-225878028 CCAATAGAAATCAATCATTTGCT No data
Right 947037695 2:225878042-225878064 GGCTATTTAATAAAGATTCTGGG No data
947037690_947037695 27 Left 947037690 2:225877992-225878014 CCTTAAGATGCATTCCAATAGAA No data
Right 947037695 2:225878042-225878064 GGCTATTTAATAAAGATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947037695 Original CRISPR GGCTATTTAATAAAGATTCT GGG Intergenic
No off target data available for this crispr