ID: 947038169

View in Genome Browser
Species Human (GRCh38)
Location 2:225884060-225884082
Sequence GTTTATGTAAGTTCACTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947038165_947038169 15 Left 947038165 2:225884022-225884044 CCTGATAGGCTAGATGTGCAACA No data
Right 947038169 2:225884060-225884082 GTTTATGTAAGTTCACTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947038169 Original CRISPR GTTTATGTAAGTTCACTTGA TGG Intergenic
No off target data available for this crispr