ID: 947043434

View in Genome Browser
Species Human (GRCh38)
Location 2:225949868-225949890
Sequence GGTTGAATGGATCCATGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947043434_947043443 25 Left 947043434 2:225949868-225949890 CCTGAGCATGGATCCATTCAACC No data
Right 947043443 2:225949916-225949938 CACCAATACATGCCACTTGTGGG No data
947043434_947043445 30 Left 947043434 2:225949868-225949890 CCTGAGCATGGATCCATTCAACC No data
Right 947043445 2:225949921-225949943 ATACATGCCACTTGTGGGCCTGG No data
947043434_947043442 24 Left 947043434 2:225949868-225949890 CCTGAGCATGGATCCATTCAACC No data
Right 947043442 2:225949915-225949937 CCACCAATACATGCCACTTGTGG No data
947043434_947043437 -2 Left 947043434 2:225949868-225949890 CCTGAGCATGGATCCATTCAACC No data
Right 947043437 2:225949889-225949911 CCTGCTGCAACCACCACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947043434 Original CRISPR GGTTGAATGGATCCATGCTC AGG (reversed) Intergenic
No off target data available for this crispr