ID: 947045102

View in Genome Browser
Species Human (GRCh38)
Location 2:225972934-225972956
Sequence CATGTAACAAGACCAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947045091_947045102 30 Left 947045091 2:225972881-225972903 CCTCAATGTCCCCCCAATTATTT No data
Right 947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG No data
947045098_947045102 -5 Left 947045098 2:225972916-225972938 CCAAATCTGCTTCTTCCCCATGT No data
Right 947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG No data
947045095_947045102 18 Left 947045095 2:225972893-225972915 CCCAATTATTTCCTTTTTCATCT No data
Right 947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG No data
947045093_947045102 20 Left 947045093 2:225972891-225972913 CCCCCAATTATTTCCTTTTTCAT No data
Right 947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG No data
947045092_947045102 21 Left 947045092 2:225972890-225972912 CCCCCCAATTATTTCCTTTTTCA No data
Right 947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG No data
947045097_947045102 7 Left 947045097 2:225972904-225972926 CCTTTTTCATCTCCAAATCTGCT No data
Right 947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG No data
947045096_947045102 17 Left 947045096 2:225972894-225972916 CCAATTATTTCCTTTTTCATCTC No data
Right 947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG No data
947045094_947045102 19 Left 947045094 2:225972892-225972914 CCCCAATTATTTCCTTTTTCATC No data
Right 947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947045102 Original CRISPR CATGTAACAAGACCAAAATC TGG Intergenic
No off target data available for this crispr