ID: 947045748

View in Genome Browser
Species Human (GRCh38)
Location 2:225981279-225981301
Sequence CTAGATTTCCAGGGATATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947045748_947045752 -2 Left 947045748 2:225981279-225981301 CCAATATATCCCTGGAAATCTAG No data
Right 947045752 2:225981300-225981322 AGAAGGCATTGTGCATGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947045748 Original CRISPR CTAGATTTCCAGGGATATAT TGG (reversed) Intergenic
No off target data available for this crispr