ID: 947046769

View in Genome Browser
Species Human (GRCh38)
Location 2:225995993-225996015
Sequence GTGACAGTCATGATTCATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947046766_947046769 26 Left 947046766 2:225995944-225995966 CCAACAGCTGGGGGTGGGCAGAG No data
Right 947046769 2:225995993-225996015 GTGACAGTCATGATTCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947046769 Original CRISPR GTGACAGTCATGATTCATAG TGG Intergenic
No off target data available for this crispr