ID: 947047358

View in Genome Browser
Species Human (GRCh38)
Location 2:226003154-226003176
Sequence AAAGGTATCCAGAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947047350_947047358 10 Left 947047350 2:226003121-226003143 CCTATTCCTCTGCTTTCCTCTAT No data
Right 947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG No data
947047348_947047358 12 Left 947047348 2:226003119-226003141 CCCCTATTCCTCTGCTTTCCTCT No data
Right 947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG No data
947047351_947047358 4 Left 947047351 2:226003127-226003149 CCTCTGCTTTCCTCTATAGAGAA No data
Right 947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG No data
947047349_947047358 11 Left 947047349 2:226003120-226003142 CCCTATTCCTCTGCTTTCCTCTA No data
Right 947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG No data
947047347_947047358 18 Left 947047347 2:226003113-226003135 CCAACTCCCCTATTCCTCTGCTT No data
Right 947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG No data
947047353_947047358 -6 Left 947047353 2:226003137-226003159 CCTCTATAGAGAAGATGAAAGGT No data
Right 947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947047358 Original CRISPR AAAGGTATCCAGAGGGGGCA TGG Intergenic
No off target data available for this crispr