ID: 947047462

View in Genome Browser
Species Human (GRCh38)
Location 2:226004774-226004796
Sequence AGACTCTAAACTAGACTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947047462_947047466 7 Left 947047462 2:226004774-226004796 CCCAAAAGTCTAGTTTAGAGTCT No data
Right 947047466 2:226004804-226004826 ATACCATCTAAATCAGATATGGG No data
947047462_947047465 6 Left 947047462 2:226004774-226004796 CCCAAAAGTCTAGTTTAGAGTCT No data
Right 947047465 2:226004803-226004825 AATACCATCTAAATCAGATATGG No data
947047462_947047468 19 Left 947047462 2:226004774-226004796 CCCAAAAGTCTAGTTTAGAGTCT No data
Right 947047468 2:226004816-226004838 TCAGATATGGGTGAGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947047462 Original CRISPR AGACTCTAAACTAGACTTTT GGG (reversed) Intergenic