ID: 947048894

View in Genome Browser
Species Human (GRCh38)
Location 2:226019821-226019843
Sequence TATGGGAGGAATGCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947048894_947048904 21 Left 947048894 2:226019821-226019843 CCTCCCACAGCATTCCTCCCATA No data
Right 947048904 2:226019865-226019887 TACAATTCAAGATGAAATTTGGG 0: 319
1: 7589
2: 10743
3: 9370
4: 8041
947048894_947048902 -5 Left 947048894 2:226019821-226019843 CCTCCCACAGCATTCCTCCCATA No data
Right 947048902 2:226019839-226019861 CCATAACACGTGAGGATTATGGG No data
947048894_947048900 -6 Left 947048894 2:226019821-226019843 CCTCCCACAGCATTCCTCCCATA No data
Right 947048900 2:226019838-226019860 CCCATAACACGTGAGGATTATGG No data
947048894_947048905 26 Left 947048894 2:226019821-226019843 CCTCCCACAGCATTCCTCCCATA No data
Right 947048905 2:226019870-226019892 TTCAAGATGAAATTTGGGTTAGG 0: 6
1: 478
2: 9045
3: 12241
4: 10287
947048894_947048903 20 Left 947048894 2:226019821-226019843 CCTCCCACAGCATTCCTCCCATA No data
Right 947048903 2:226019864-226019886 CTACAATTCAAGATGAAATTTGG 0: 200
1: 4567
2: 7583
3: 9144
4: 9302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947048894 Original CRISPR TATGGGAGGAATGCTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr