ID: 947056157

View in Genome Browser
Species Human (GRCh38)
Location 2:226106955-226106977
Sequence TCAGTCTGTGAATACAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947056157_947056159 24 Left 947056157 2:226106955-226106977 CCTGGGTTGTATTCACAGACTGA No data
Right 947056159 2:226107002-226107024 TTACCCAAGTAGTAAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947056157 Original CRISPR TCAGTCTGTGAATACAACCC AGG (reversed) Intergenic
No off target data available for this crispr