ID: 947058195

View in Genome Browser
Species Human (GRCh38)
Location 2:226131845-226131867
Sequence ATTGCTGGTGTTGCTGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947058195_947058199 10 Left 947058195 2:226131845-226131867 CCCCATTCAGCAACACCAGCAAT No data
Right 947058199 2:226131878-226131900 CATTTTCCTATTATGTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947058195 Original CRISPR ATTGCTGGTGTTGCTGAATG GGG (reversed) Intergenic
No off target data available for this crispr