ID: 947059298

View in Genome Browser
Species Human (GRCh38)
Location 2:226144636-226144658
Sequence GGAGCTGTTTCCAGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947059298_947059305 13 Left 947059298 2:226144636-226144658 CCTGGCACACTGGAAACAGCTCC No data
Right 947059305 2:226144672-226144694 GCACCTCACCCTGGTTATGCTGG No data
947059298_947059309 28 Left 947059298 2:226144636-226144658 CCTGGCACACTGGAAACAGCTCC No data
Right 947059309 2:226144687-226144709 TATGCTGGAAGCAGCTAGAGTGG No data
947059298_947059304 4 Left 947059298 2:226144636-226144658 CCTGGCACACTGGAAACAGCTCC No data
Right 947059304 2:226144663-226144685 CCTGCTGGAGCACCTCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947059298 Original CRISPR GGAGCTGTTTCCAGTGTGCC AGG (reversed) Intergenic