ID: 947059345

View in Genome Browser
Species Human (GRCh38)
Location 2:226145209-226145231
Sequence GGTTCAACACACAAATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947059345_947059354 18 Left 947059345 2:226145209-226145231 CCCCAAAATTTGTGTGTTGAACC No data
Right 947059354 2:226145250-226145272 GTATTTGGATTGGGAGCTGTTGG No data
947059345_947059355 30 Left 947059345 2:226145209-226145231 CCCCAAAATTTGTGTGTTGAACC No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059345_947059353 9 Left 947059345 2:226145209-226145231 CCCCAAAATTTGTGTGTTGAACC No data
Right 947059353 2:226145241-226145263 ATTATGACTGTATTTGGATTGGG No data
947059345_947059351 3 Left 947059345 2:226145209-226145231 CCCCAAAATTTGTGTGTTGAACC No data
Right 947059351 2:226145235-226145257 CATCTCATTATGACTGTATTTGG No data
947059345_947059352 8 Left 947059345 2:226145209-226145231 CCCCAAAATTTGTGTGTTGAACC No data
Right 947059352 2:226145240-226145262 CATTATGACTGTATTTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947059345 Original CRISPR GGTTCAACACACAAATTTTG GGG (reversed) Intergenic