ID: 947059346

View in Genome Browser
Species Human (GRCh38)
Location 2:226145210-226145232
Sequence GGGTTCAACACACAAATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947059346_947059354 17 Left 947059346 2:226145210-226145232 CCCAAAATTTGTGTGTTGAACCC No data
Right 947059354 2:226145250-226145272 GTATTTGGATTGGGAGCTGTTGG No data
947059346_947059353 8 Left 947059346 2:226145210-226145232 CCCAAAATTTGTGTGTTGAACCC No data
Right 947059353 2:226145241-226145263 ATTATGACTGTATTTGGATTGGG No data
947059346_947059355 29 Left 947059346 2:226145210-226145232 CCCAAAATTTGTGTGTTGAACCC No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059346_947059351 2 Left 947059346 2:226145210-226145232 CCCAAAATTTGTGTGTTGAACCC No data
Right 947059351 2:226145235-226145257 CATCTCATTATGACTGTATTTGG No data
947059346_947059352 7 Left 947059346 2:226145210-226145232 CCCAAAATTTGTGTGTTGAACCC No data
Right 947059352 2:226145240-226145262 CATTATGACTGTATTTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947059346 Original CRISPR GGGTTCAACACACAAATTTT GGG (reversed) Intergenic