ID: 947059347

View in Genome Browser
Species Human (GRCh38)
Location 2:226145211-226145233
Sequence GGGGTTCAACACACAAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947059347_947059354 16 Left 947059347 2:226145211-226145233 CCAAAATTTGTGTGTTGAACCCC No data
Right 947059354 2:226145250-226145272 GTATTTGGATTGGGAGCTGTTGG No data
947059347_947059352 6 Left 947059347 2:226145211-226145233 CCAAAATTTGTGTGTTGAACCCC No data
Right 947059352 2:226145240-226145262 CATTATGACTGTATTTGGATTGG No data
947059347_947059355 28 Left 947059347 2:226145211-226145233 CCAAAATTTGTGTGTTGAACCCC No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059347_947059351 1 Left 947059347 2:226145211-226145233 CCAAAATTTGTGTGTTGAACCCC No data
Right 947059351 2:226145235-226145257 CATCTCATTATGACTGTATTTGG No data
947059347_947059353 7 Left 947059347 2:226145211-226145233 CCAAAATTTGTGTGTTGAACCCC No data
Right 947059353 2:226145241-226145263 ATTATGACTGTATTTGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947059347 Original CRISPR GGGGTTCAACACACAAATTT TGG (reversed) Intergenic