ID: 947059348

View in Genome Browser
Species Human (GRCh38)
Location 2:226145230-226145252
Sequence TACAGTCATAATGAGATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947059348_947059356 17 Left 947059348 2:226145230-226145252 CCCCTCATCTCATTATGACTGTA No data
Right 947059356 2:226145270-226145292 TGGAAGATAACCAGGACATGAGG No data
947059348_947059357 21 Left 947059348 2:226145230-226145252 CCCCTCATCTCATTATGACTGTA No data
Right 947059357 2:226145274-226145296 AGATAACCAGGACATGAGGCTGG No data
947059348_947059354 -3 Left 947059348 2:226145230-226145252 CCCCTCATCTCATTATGACTGTA No data
Right 947059354 2:226145250-226145272 GTATTTGGATTGGGAGCTGTTGG No data
947059348_947059355 9 Left 947059348 2:226145230-226145252 CCCCTCATCTCATTATGACTGTA No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947059348 Original CRISPR TACAGTCATAATGAGATGAG GGG (reversed) Intergenic