ID: 947059350

View in Genome Browser
Species Human (GRCh38)
Location 2:226145232-226145254
Sequence AATACAGTCATAATGAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947059350_947059354 -5 Left 947059350 2:226145232-226145254 CCTCATCTCATTATGACTGTATT No data
Right 947059354 2:226145250-226145272 GTATTTGGATTGGGAGCTGTTGG No data
947059350_947059356 15 Left 947059350 2:226145232-226145254 CCTCATCTCATTATGACTGTATT No data
Right 947059356 2:226145270-226145292 TGGAAGATAACCAGGACATGAGG No data
947059350_947059355 7 Left 947059350 2:226145232-226145254 CCTCATCTCATTATGACTGTATT No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059350_947059357 19 Left 947059350 2:226145232-226145254 CCTCATCTCATTATGACTGTATT No data
Right 947059357 2:226145274-226145296 AGATAACCAGGACATGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947059350 Original CRISPR AATACAGTCATAATGAGATG AGG (reversed) Intergenic