ID: 947059355

View in Genome Browser
Species Human (GRCh38)
Location 2:226145262-226145284
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947059345_947059355 30 Left 947059345 2:226145209-226145231 CCCCAAAATTTGTGTGTTGAACC No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059348_947059355 9 Left 947059348 2:226145230-226145252 CCCCTCATCTCATTATGACTGTA No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059347_947059355 28 Left 947059347 2:226145211-226145233 CCAAAATTTGTGTGTTGAACCCC No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059346_947059355 29 Left 947059346 2:226145210-226145232 CCCAAAATTTGTGTGTTGAACCC No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059349_947059355 8 Left 947059349 2:226145231-226145253 CCCTCATCTCATTATGACTGTAT No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data
947059350_947059355 7 Left 947059350 2:226145232-226145254 CCTCATCTCATTATGACTGTATT No data
Right 947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type