ID: 947062203

View in Genome Browser
Species Human (GRCh38)
Location 2:226179602-226179624
Sequence AATGAGAAGCCTGATAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947062198_947062203 2 Left 947062198 2:226179577-226179599 CCTTAGCCATCTGTTGAACCCTG No data
Right 947062203 2:226179602-226179624 AATGAGAAGCCTGATAAGGAAGG No data
947062199_947062203 -4 Left 947062199 2:226179583-226179605 CCATCTGTTGAACCCTGAAAATG No data
Right 947062203 2:226179602-226179624 AATGAGAAGCCTGATAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947062203 Original CRISPR AATGAGAAGCCTGATAAGGA AGG Intergenic
No off target data available for this crispr