ID: 947063006

View in Genome Browser
Species Human (GRCh38)
Location 2:226187998-226188020
Sequence CCTTCTATGGAGTAGTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947063003_947063006 26 Left 947063003 2:226187949-226187971 CCAGGGTCTAAAACTACAAGTGA No data
Right 947063006 2:226187998-226188020 CCTTCTATGGAGTAGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947063006 Original CRISPR CCTTCTATGGAGTAGTTCCA AGG Intergenic
No off target data available for this crispr