ID: 947068733

View in Genome Browser
Species Human (GRCh38)
Location 2:226261678-226261700
Sequence GTGTAAATCATCAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947068733_947068740 27 Left 947068733 2:226261678-226261700 CCTTTCTCCCTGATGATTTACAC No data
Right 947068740 2:226261728-226261750 CTACTGACGGTGAAAAGGGGAGG No data
947068733_947068738 23 Left 947068733 2:226261678-226261700 CCTTTCTCCCTGATGATTTACAC No data
Right 947068738 2:226261724-226261746 TTATCTACTGACGGTGAAAAGGG No data
947068733_947068736 14 Left 947068733 2:226261678-226261700 CCTTTCTCCCTGATGATTTACAC No data
Right 947068736 2:226261715-226261737 AAGAAGCAGTTATCTACTGACGG No data
947068733_947068737 22 Left 947068733 2:226261678-226261700 CCTTTCTCCCTGATGATTTACAC No data
Right 947068737 2:226261723-226261745 GTTATCTACTGACGGTGAAAAGG No data
947068733_947068739 24 Left 947068733 2:226261678-226261700 CCTTTCTCCCTGATGATTTACAC No data
Right 947068739 2:226261725-226261747 TATCTACTGACGGTGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947068733 Original CRISPR GTGTAAATCATCAGGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr