ID: 947068740

View in Genome Browser
Species Human (GRCh38)
Location 2:226261728-226261750
Sequence CTACTGACGGTGAAAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947068734_947068740 20 Left 947068734 2:226261685-226261707 CCCTGATGATTTACACTTTCTTT No data
Right 947068740 2:226261728-226261750 CTACTGACGGTGAAAAGGGGAGG No data
947068733_947068740 27 Left 947068733 2:226261678-226261700 CCTTTCTCCCTGATGATTTACAC No data
Right 947068740 2:226261728-226261750 CTACTGACGGTGAAAAGGGGAGG No data
947068735_947068740 19 Left 947068735 2:226261686-226261708 CCTGATGATTTACACTTTCTTTG No data
Right 947068740 2:226261728-226261750 CTACTGACGGTGAAAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947068740 Original CRISPR CTACTGACGGTGAAAAGGGG AGG Intergenic
No off target data available for this crispr