ID: 947077248

View in Genome Browser
Species Human (GRCh38)
Location 2:226358520-226358542
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947077248_947077249 14 Left 947077248 2:226358520-226358542 CCTCTACAGTACAGAATGGGGGT No data
Right 947077249 2:226358557-226358579 TCTTGAAAATTCCTTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947077248 Original CRISPR ACCCCCATTCTGTACTGTAG AGG (reversed) Intergenic
No off target data available for this crispr