ID: 947079762

View in Genome Browser
Species Human (GRCh38)
Location 2:226383068-226383090
Sequence ATTTAGTTCTGTAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947079758_947079762 -4 Left 947079758 2:226383049-226383071 CCTAAATGAAGACAGTGAAATTT No data
Right 947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947079762 Original CRISPR ATTTAGTTCTGTAGGGAAGA GGG Intergenic
No off target data available for this crispr