ID: 947083110

View in Genome Browser
Species Human (GRCh38)
Location 2:226420757-226420779
Sequence CTGAATCAGCAAATCTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947083110_947083111 -9 Left 947083110 2:226420757-226420779 CCTTGAAAGATTTGCTGATTCAG No data
Right 947083111 2:226420771-226420793 CTGATTCAGAAGCTCATCACTGG No data
947083110_947083112 22 Left 947083110 2:226420757-226420779 CCTTGAAAGATTTGCTGATTCAG No data
Right 947083112 2:226420802-226420824 ATGAGATCAGCCTTAGTGAGTGG No data
947083110_947083113 23 Left 947083110 2:226420757-226420779 CCTTGAAAGATTTGCTGATTCAG No data
Right 947083113 2:226420803-226420825 TGAGATCAGCCTTAGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947083110 Original CRISPR CTGAATCAGCAAATCTTTCA AGG (reversed) Intergenic
No off target data available for this crispr