ID: 947089544

View in Genome Browser
Species Human (GRCh38)
Location 2:226494892-226494914
Sequence CTGCATCTTCATTTCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947089535_947089544 8 Left 947089535 2:226494861-226494883 CCACCTATGTCTTACTTGCCCTT No data
Right 947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG No data
947089536_947089544 5 Left 947089536 2:226494864-226494886 CCTATGTCTTACTTGCCCTTCTT No data
Right 947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG No data
947089534_947089544 15 Left 947089534 2:226494854-226494876 CCATAGACCACCTATGTCTTACT No data
Right 947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG No data
947089537_947089544 -10 Left 947089537 2:226494879-226494901 CCCTTCTTTCCCCCTGCATCTTC No data
Right 947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947089544 Original CRISPR CTGCATCTTCATTTCCAGCA GGG Intergenic
No off target data available for this crispr